all | frequencies |
|
exhibits | applications |
---|---|---|---|---|
manual |
app s | submitted / available | |||||||
---|---|---|---|---|---|---|---|---|
1 |
|
15 iCG80 UserMan | Users Manual | 2.44 MiB | ||||
1 | Attestation Statements | |||||||
1 | Cover Letter(s) | |||||||
1 | ID Label/Location Info | |||||||
1 | External Photos | |||||||
1 | Internal Photos | |||||||
1 | Test Setup Photos | |||||||
1 | Test Report | |||||||
1 | Test Report | |||||||
1 | Test Report | |||||||
1 | Operational Description | |||||||
1 | RF Exposure Info | |||||||
1 | Cover Letter(s) |
1 | 15 iCG80 UserMan | Users Manual | 2.44 MiB |
Leica iCON gps 80 User Manual Version 2.7 English Introduction Purchase Congratulations on the purchase of a Leica iCON gps 80 system. This manual contains important safety directions as well as instructions for setting up the product and operating it. Refer to "1 Safety Directions" for further information. Read carefully through the User Manual before you switch on the product. Product Identifica-
tion The model and serial number of your product are indicated on the type plate. Always refer to this information when you need to contact your agency or Leica Geosystems authorised service workshop. Trademarks Bluetooth is a registered trademark of Bluetooth SIG, Inc. All other trademarks are the property of their respective owners. Validity of this manual Available documen-
tation This manual applies to the Leica iCON gps 80 instrument and the Leica CGA60 antenna. Name Description/Format Leica iCON gps 80 Quick Guide Leica iCON gps 80 User Manual Provides an overview of the product together with tech-
nical data and safety directions. Intended as a quick reference field guide. All instructions required in order to operate the product to a basic level are contained in the User Manual. Provides an overview of the product together with tech-
nical data and safety directions.
Refer to the following resources for all Leica iCON gps 80 documentation/soft-
ware:
https://myworld.leica-geosystems.com the Leica USB documentation card. myWorld@Leica Geosystems (https://myworld.leica-geosystems.com) offers a wide range of services, information and training material. With direct access to myWorld, you are able to access all relevant services whenever it is convenient for you, 24 hours a day, 7 days per week. This increases your efficiency and keeps you and your equipment instantly updated with the latest information from Leica Geosystems. Service myProducts myService mySupport Description Add all products that you and your company own and explore your world of Leica Geosystems: View detailed information on your prod-
ucts and update your products with the latest software and keep up-
to-date with the latest documentation. View the current service status and full service history of your prod-
ucts in Leica Geosystems service centres. Access detailed informa-
tion on the services performed and download your latest calibration certificates and service reports. View the current service status and full service history of your prod-
ucts in Leica Geosystems service centres. Access detailed informa-
tion on the services performed and download your latest calibration certificates and service reports. iCON gps 80, Introduction 2 Service myTraining myTrustedSer-
vices Description Enhance your product knowledge with Leica Geosystems Campus -
Information, Knowledge, Training. Study the latest online training material on your products and register for seminars or courses in your country. Add your subscriptions and manage users for Leica Geosystems Trusted Services, the secure software services, that assist you to optimise your workflow and increase your efficiency. iCON gps 80, Introduction 3 Table of Contents In this manual Chapter 1 2 3 4 5 iCON gps 80 Dual GNSS Container iCON gps 80 Base Station Container General Introduction Definition of Use Limits of Use Responsibilities Hazards of Use Electromagnetic Compatibility EMC FCC Statement, Applicable in U.S. Safety Directions 1.1 1.2 1.3 1.4 1.5 1.6 1.7 Description of the System System Components 2.1 General Information 2.1.1 2.1.2 Power Concept Unpacking the Container 2.2.1 2.2.2 Instrument Components 2.2 2.3 Using iCON gps 80 3.1 3.2 3.3 3.4 3.5 3.6 3.7 3.8 Power Supply Installing a SIM Card Slot-in-Device External Radios Using USB Memory Devices Quick Release Machine Bracket CMB6 Installation on a Machine Antenna Heights 3.8.1 3.8.2 3.8.3 3.8.4 3.8.5 Dual GNSS Positioning and Heading Single GNSS Setup, with Internal Radio Single GNSS Setup, with External Radio Dual GNSS Setup, with Internal Radio Local Base Station Setup, on Tripod Local Base Station Setup, on Pillar Local Base Station Setup, with External Radio Local Base Station Setup, Permanent 3.9 Setups with Accessories 4.1 4.2 4.3 4.4 4.5 4.6 4.7 iCON gps 80 User Interface 5.1 5.2 5.3 User Interface Description Main Menu Submenus 5.3.1 5.3.2 5.3.3 iCON gps 80 Screen in Machine Control Mode Navigation in Submenus How to Change Settings and Edit Values Available Sub Menus Understanding Antenna Heights The Mechanical Reference Plane, MRP Measuring the Antenna Height for a Pillar Setup Measuring the Antenna Height for a Tripod Setup Measuring the Antenna Height for a Mast Setup 5.4 iCON gps 80, Table of Contents Page 7 7 7 8 8 9 12 13 15 15 15 17 18 18 19 20 23 23 23 24 25 27 28 29 33 33 34 34 35 36 36 38 38 39 40 41 42 43 44 46 46 47 50 50 51 53 60 4 6 7 8 9 Software Tools 6.1 Base Setup Description Manual Base Setup Base Setup using BasePilot Base Setup 6.1.1 6.1.2 6.1.3 Rover Setup ORP and NMEA Output Raw Data Logging iCON Telematics Import, Export, or Delete Data Licensing 6.2 6.3 6.4 6.5 6.6 6.7 Coordinate Systems Transport Storage Cleaning and Drying Care and Transport 8.1 8.2 8.3 Technical Data 9.1 9.2 9.3 9.4 Tracking Characteristics Accuracy General Technical Data of the Instrument Technical Data iCON gps 80 9.1.1 9.1.2 9.1.3 Antennas Technical Data Pin Assignments and Sockets Conformity Declarations 9.4.1 9.4.2 iCON gps 80 GFU14, SATEL Satelline 3AS, GFU27, SATEL Satelline M3-TR1 GFU15, Pacific Crest PDL Intuicom 1200DL TFR-300L CCD14 - SATEL TA13 CCD15 - Intuicom 900SLR 9.4.3 9.4.4 9.4.5 9.4.6 9.4.7 10 Software Licence Agreement Appendix A NMEA Message Formats A.1 A.2 A.3 A.4 A.5 A.6 A.7 A.8 A.9 A.10 A.11 A.12 A.13 A.14 A.15 A.16 Overview Symbols Used for Describing the NMEA Formats GGA - Global Positioning System Fix Data GGK - Real-Time Position with DOP GGQ - Real-Time Position with CQ GLL - Geographic Position Latitude/Longitude GNS - GNSS Fix Data GSA - GNSS DOP and Active Satellites GSV - GNSS Satellites in View HDT - Heading, True LLK - Leica Local Position and GDOP LLQ - Leica Local Position and Quality RMC - Recommended Minimum Specific GNSS Data VTG - Course Over Ground and Ground Speed XDR Transducer Measurements ZDA - Time and Date iCON gps 80, Table of Contents 62 62 62 62 76 77 85 87 87 91 93 94 95 95 95 95 96 96 96 96 97 100 101 103 103 105 106 107 108 109 110 112 113 113 113 115 116 117 118 118 119 120 121 121 122 123 123 124 124 5 Appendix B ORP Orientation and Position Appendix C C.1 C.2 C.3 C.4 Glossary C G N W 126 129 129 130 131 133 iCON gps 80, Table of Contents 6 1 1.1 Safety Directions General Introduction Description The following directions enable the person responsible for the product, and the person who actually uses the equipment, to anticipate and avoid operational hazards. The person responsible for the product must ensure that all users understand these directions and adhere to them. About Warning Messages Warning messages are an essential part of the safety concept of the instrument. They appear wherever hazards or hazardous situations can occur. Warning messages... make the user alert about direct and indirect hazards concerning the use of the product. contain general rules of behaviour. For the users safety, all safety instructions and safety messages shall be strictly observed and followed! Therefore, the manual must always be available to all persons performing any tasks described here. DANGER, WARNING, CAUTION and NOTICE are standardised signal words for iden-
tifying levels of hazards and risks related to personal injury and property damage. For your safety, it is important to read and fully understand the following table with the different signal words and their definitions! Supplementary safety information symbols may be placed within a warning message as well as supplementary text. Type DANGER WARNING CAUTION NOTICE
Description Indicates an imminently hazardous situation which, if not avoided, will result in death or serious injury. Indicates a potentially hazardous situation or an unintended use which, if not avoided, could result in death or serious injury. Indicates a potentially hazardous situation or an unintended use which, if not avoided, may result in minor or moderate injury. Indicates a potentially hazardous situation or an unintended use which, if not avoided, may result in appreciable material, financial and environmental damage. Important paragraphs which must be adhered to in practice as they enable the product to be used in a technically correct and efficient manner. iCON gps 80, Safety Directions 7 1.2 Definition of Use Intended use Reasonably fore-
seeable misuse Computing with software. Carrying out measurement tasks using various GNSS measuring techniques. Recording GNSS and point related data. Remote control of product. Data communication with external appliances. Measuring raw data and computing coordinates using carrier phase and code signal from GNSS satellites. Use of the product without instruction. Use outside of the intended use and limits. Disabling safety systems. Removal of hazard notices. Opening the product using tools, for example screwdriver, unless this is permitted for certain functions. Modification or conversion of the product. Use after misappropriation. Use of products with obvious damages or defects. Use with accessories from other manufacturers without the prior explicit approval of Leica Geosystems. Inadequate safeguards at the working site. Controlling of machines, moving objects or similar monitoring application without additional control and safety installations. WARNING Unauthorised modification of building and constructions machines by mounting or installing the product may alter the function and safety of the machine. Precautions:
Follow the instructions of the machine manufacturer. If no appropriate instruction is available, ask machine manufacturer for instructions before mounting or installing the product. 1.3 Limits of Use Environment DANGER Suitable for use in an atmosphere appropriate for permanent human habitation: not suitable for use in aggressive or explosive environments. Local safety authorities and safety experts must be contacted before working in hazardous areas, or close to electrical installations or similar situations by the person in charge of the product. 1.4 Responsibilities Manufacturer of the product Leica Geosystems AG, CH-9435 Heerbrugg, hereinafter referred to as Leica Geosys-
tems, is responsible for supplying the product, including the user manual and original accessories, in a safe condition. Person responsible for the product The person responsible for the product has the following duties:
To understand the safety instructions on the product and the instructions in the To ensure that it is used in accordance with the instructions. To be familiar with local regulations relating to safety and accident prevention. To inform Leica Geosystems immediately if the product and the application user manual. becomes unsafe. iCON gps 80, Safety Directions 8 To ensure that the national laws, regulations and conditions for the operation of e.g. radio transmitters or lasers are respected. To ensure that the radio modem is not operated without the permission of the local authorities on frequencies and/or output power levels other than those specifically reserved and intended for use without a specific permit. The internal and external radio modems have been designed to operate on frequency ranges and output power ranges, the exact use of which differs from one region and/or country to another. WARNING 1.5 CAUTION CAUTION DANGER WARNING WARNING CAUTION This product must be installed on building and construction machinery only by an appropriately trained and qualified specialist. Hazards of Use Installing near mechanically moving machine components may damage the product. Precautions:
Deflect the mechanically moving machine components as far as possible and define a safe installation zone. Watch out for erroneous measurement results if the product has been dropped or has been misused, modified, stored for long periods or transported. Precautions:
Periodically carry out test measurements and perform the field adjustments indicated in the user manual, particularly after the product has been subjected to abnormal use as well as before and after important measurements. Because of the risk of electrocution, it is dangerous to use poles and extensions in the vicinity of electrical installations such as power cables or electrical railways. Precautions:
Keep at a safe distance from electrical installations. If it is essential to work in this environment, first contact the safety authorities responsible for the electrical instal-
lations and follow their instructions. During dynamic applications, for example stakeout procedures there is a danger of accidents occurring if the user does not pay attention to the environmental conditions around, for example obstacles, excavations or traffic. Precautions:
The person responsible for the product must make all users fully aware of the existing dangers. Inadequate securing of the working site can lead to dangerous situations, for example in traffic, on building sites and at industrial installations. Precautions:
Always ensure that the working site is adequately secured. Adhere to the regulations governing safety, accident prevention and road traffic. If the accessories used with the product are not properly secured and the product is subjected to mechanical shock, for example blows or falling, the product may be damaged or people can sustain injury. iCON gps 80, Safety Directions 9 WARNING DANGER Precautions:
When setting-up the product, make sure that the accessories are correctly adapted, fitted, secured, and locked in position. Avoid subjecting the product to mechanical stress. If the product is used with accessories, for example masts, staffs, poles, you may increase the risk of being struck by lightning. Precautions:
Do not use the product in a thunderstorm. If the product is used with accessories, for example on masts, staffs, poles, you may increase the risk of being struck by lightning. Danger from high voltages also exists near power lines. Lightning, voltage peaks, or the touching of power lines can cause damage, injury and death. Precautions:
Do not use the product in a thunderstorm as you can increase the risk of being struck by lightning. Be sure to remain at a safe distance from electrical installations. Do not use the product directly under or close to power lines. If it is essential to work in such an environment contact the safety authorities responsible for electrical installations and follow their instructions. If the product has to be permanently mounted in an exposed location, it is advis-
able to provide a lightning conductor system. A suggestion on how to design a lightning conductor for the product is given below. Always follow the regulations in force in your country regarding grounding antennas and masts. These installations must be carried out by an authorised specialist. To prevent damages due to indirect lightning strikes (voltage spikes) cables, for example for antenna, power source or modem should be protected with appro-
priate protection elements, like a lightning arrester. These installations must be carried out by an authorised specialist. If there is a risk of a thunderstorm, or if the equipment is to remain unused and unattended for a long period, protect your product additionally by unplugging all systems components and disconnecting all connecting cables and supply cables, for example, instrument - antenna. Lightning conduc-
tors Suggestion for design of a lightning conductor for a GNSS system:
1) On non-metallic structures Protection by air terminals is recommended. An air terminal is a pointed solid or tubular rod of conducting material with proper mounting and connection to a conductor. The position of four air terminals can be uniformly distributed around the antenna at a distance equal to the height of the air terminal. The air terminal diameter should be 12 mm for copper or 15 mm for aluminium. The height of the air terminals should be 25 cm to 50 cm. All air terminals should be connected to the down conductors. The diameter of the air terminal should be kept to a minimum to reduce GNSS signal shading. 2) On metallic structures Protection is as described for non-metallic structures, but the air terminals can be connected directly to the conducting structure without the need for down conduc-
tors. iCON gps 80, Safety Directions 10 Air terminal arrangement, plan view Grounding the instrument/antenna GS_039 GS_040 a b c a b c d e a) Antenna b) Support structure c) Air terminal a) Antenna b) Lightning conductor array c) Antenna/instrument connection d) Metallic mast e) Connection to earth CAUTION WARNING WARNING WARNING CAUTION During the transport, shipping or disposal of batteries it is possible for inappropriate mechanical influences to constitute a fire hazard. Precautions:
Before shipping the product or disposing of it, discharge the batteries by running the product until they are flat. When transporting or shipping batteries, the person in charge of the product must ensure that the applicable national and international rules and regulations are observed. Before transportation or shipping contact your local passenger or freight transport company. High mechanical stress, high ambient temperatures or immersion into fluids can cause leakage, fire or explosions of the batteries. Precautions:
Protect the batteries from mechanical influences and high ambient temperatures. Do not drop or immerse batteries into fluids. If battery terminals are short circuited e.g. by coming in contact with jewellery, keys, metalized paper or other metals, the battery can overheat and cause injury or fire, for example by storing or transporting in pockets. Precautions:
Make sure that the battery terminals do not come into contact with metallic objects. Incorrect fastening of the external antenna to vehicles or transporters poses the risk of the equipment being broken by mechanical influence, vibration or airstream. This may result in accident and physical injury. Precautions:
Attach the external antenna professionally. The external antenna must be secured additionally, for example by use of a safety cord. Ensure that the mounting device is correctly mounted and able to carry the weight of the external antenna (>1 kg) safely. Beware of inadequate steering if machine is defective like after a crash or other damaging events or alterations to the machine. Precautions:
Periodically perform control measurements and field adjustments on the machine as specified in the User Manual. While working, construction and grading should be checked by appropriate means, for example spirit level, tachymeter, before and after important measuring tasks. iCON gps 80, Safety Directions 11 WARNING WARNING WARNING 1.6 Description WARNING CAUTION While steering or navigating the machine accidents can occur due to a) the operator not paying attention to the surroundings (persons, ditches, traffic, etc.), or b) malfunctions ( of a system component, interference, etc.). Precautions:
The operator assures that the machine is operated, guided and monitored by a quali-
fied user (e.g. driver). The user has to be able to take emergency measures, for example an emergency stop. If the product is improperly disposed of, the following can happen:
If polymer parts are burnt, poisonous gases are produced which may impair health. If batteries are damaged or are heated strongly, they can explode and cause poisoning, burning, corrosion or environmental contamination. By disposing of the product irresponsibly you may enable unauthorised persons to use it in contravention of the regulations, exposing themselves and third parties to the risk of severe injury and rendering the environment liable to contamination. Precautions:
The product must not be disposed with household waste. Dispose of the product appropriately in accordance with the national regulations in force in your country. Always prevent access to the product by unauthorised personnel. Product-specific treatment and waste management information can be downloaded from the Leica Geosystems home page at http://www.leica-
geosystems.com/treatment or received from your Leica Geosystems distributor. Only Leica Geosystems authorised service workshops are entitled to repair these prod-
ucts. Electromagnetic Compatibility EMC The term Electromagnetic Compatibility is taken to mean the capability of the product to function smoothly in an environment where electromagnetic radiation and electro-
static discharges are present, and without causing electromagnetic disturbances to other equipment. Electromagnetic radiation can cause disturbances in other equipment. Although the product meets the strict regulations and standards which are in force in this respect, Leica Geosystems cannot completely exclude the possibility that other equipment may be disturbed. There is a risk that disturbances may be caused in other equipment if the product is used with accessories from other manufacturers, for example field computers, personal computers or other electronic equipment, non-standard cables or external batteries. Precautions:
Use only the equipment and accessories recommended by Leica Geosystems. When combined with the product, they meet the strict requirements stipulated by the guide-
lines and standards. When using computers or other electronic equipment, pay atten-
tion to the information about electromagnetic compatibility provided by the manufac-
turer. iCON gps 80, Safety Directions 12 CAUTION CAUTION Radios or Digital Cellular Phones WARNING Disturbances caused by electromagnetic radiation can result in erroneous measure-
ments. Although the product meets the strict regulations and standards which are in force in this respect, Leica Geosystems cannot completely exclude the possibility that the product may be disturbed by intense electromagnetic radiation, for example, near radio transmitters, two-way radios or diesel generators. Precautions:
Check the plausibility of results obtained under these conditions. If the product is operated with connecting cables attached at only one of their two ends, for example external supply cables, interface cables, the permitted level of elec-
tromagnetic radiation may be exceeded and the correct functioning of other products may be impaired. Precautions:
While the product is in use, connecting cables, for example product to external battery, product to computer, must be connected at both ends. Use of product with radio or digital cellular phone devices:
Electromagnetic fields can cause disturbances in other equipment, in installations, in medical devices, for example pacemakers or hearing aids and in aircraft. It can also affect humans and animals. Precautions:
Although the product meets the strict regulations and standards which are in force in this respect, Leica Geosystems cannot completely exclude the possibility that other equipment can be disturbed or that humans or animals can be affected. Do not operate the product with radio or digital cellular phone devices in the vicinity of filling stations or chemical installations, or in other areas where an explosion hazard exists. Do not operate the product with radio or digital cellular phone devices near to medical equipment. Do not operate the product with radio or digital cellular phone devices in aircraft. iCON gps 80, Safety Directions 13 1.7
WARNING WARNING Labelling iCON gps 80 Labelling CGA60 FCC Statement, Applicable in U.S. The greyed paragraph below is only applicable for products without radio, digital cellular phone devices. This equipment has been tested and found to comply with the limits for a Class B digital device, pursuant to part 15 of the FCC rules. These limits are designed to provide reasonable protection against harmful interfer-
ence in a residential installation. This equipment generates, uses and can radiate radio frequency energy and, if not installed and used in accordance with the instructions, may cause harmful interference to radio communications. However, there is no guarantee that interference will not occur in a particular installation. If this equipment does cause harmful interference to radio or television reception, which can be determined by turning the equipment off and on, the user is encouraged to try to correct the interference by one or more of the following measures:
Reorient or relocate the receiving antenna. Connect the equipment into an outlet on a circuit different from that to which the Increase the separation between the equipment and the receiver. receiver is connected. Consult the dealer or an experienced radio/TV technician for help. Changes or modifications not expressly approved by Leica Geosystems for compliance could void the user's authority to operate the equipment. S.No.: 1234567 222222345 S.Nooooooooooo.: 1: 1.: 11111: 11: 11:.: 1 111:::: 1111::: 1:: 11111111... 1222222345 666666666767676777777766666677767777776666667777776666676677776777777666666667777777777766666666666777777777676666677777777776676677777776667676777 234534333332345 23455555 2345 222345322222232223333332222222222345 234533333333444445 2345 22222345 2222233333333334444555 2345 2222223223333333334444455 22345 2222223333333334544442345555 232223232223345333444455 22223333 Art.No.: 8052xx AAAAAAAAArt.ArAAAAArArArArArtAAAAAAAArAAAAArAAAAArAAAAAAAAAArAAArArAAAArAAAAAAAAAArrrrrAAAAAAAArrrrrrAAAAAArAArrrrAAAAAAArrrrrAAAAAAAAAArrrrrAAAAArrrAAAAArrAAAAAAAArrrrrrAAAAAAArrrrrrAAAAAAArrrrrAArAArr No.:No :NoNoNNNNNo :Nooo :NoNNNNNooNNNNNNoNoNoNNNNNNoNNNNNoNoooNo :NoNNNNNooNo ::::Noooooo ::::NNNNoooooooo ::::NNNNooooooo ::::No :NoNo :No :: 8058058058888888888058000800500000058058058058088880000005555888058888000000055550580580000000080505555558058888000800000050055555580588800000000005550555558058888800000000055555580588880000000055555805880580052xx2xx22xxxxxx2xx2xxxx2xxxx2xx22xxxx2xx2222xxxxxxxxxxxxxxxxxxxxxx22222xxxxxxxxxxxxxxxxxxxxxx22222xxxxxxxxxxxxxxxx222xxxxxxxxxxxxxxxx22xxxxxx Model: iCG8x ModMMMododoooddddddddddddddoddddddooddddddddddddddoddddddddddddddddddddddddddddddddooodddddddddddddddoododddddddddoddddddodddddddddddddddoooddddddddoooooooooddddddddddddddododooooddddddddddddel:l:el:el:elel:elel::eelel:eeeeeeellllll:el:elel:elel:ellleleeleeeel:eelllel:eel:eeeleeeel:ell:lllel:el:el:eeeeellllel:el:lllll:el:eeleeeeeel:lllel::elleeeeeeeellel::eeeeeeeeelll:::eeeeeell::::eeeeeeeeelll:::::eeleeeeleeleeeeell::::::eeeeeeel:ee :::: CiiiCCiCCCCCCCCCiCCCCCCCiiiiiCCCCCCCCCiiiiiCCiCCCCCCCCCiCiiiiCCCCCCCCiCCiiiiCCCiiiCCCiiCCCCiiiiCCiiCCCiCiiiCCCCCCCCCiiiiCCCCCCCCCiiiiiCCCCCiCCCCiiiiCiCCCCCCCCCCCCCiiCiiCCCCCCCCCCCG8xG8xGGGG8xG8xG8GG8xGG8x8x88xG8xG8xx8x88x8GG8888xG8xG8GG88G8x8xGG8x888x8x8G8x8xG888xx8x88G8x888888xGG8x88888888xxxxxxxxxx8xGG8x88G888888888xxxxxxG88xxxxxx88888x88888xxxxxxxxx88888888xxxxxxxxx8888x8x888x888xxxxxxxx8888888888xxxxxGGGGGG8xG88888x8x88x88888xxxxxGGG8xGGG88x8x8x888xxxxx Equip. No.: 12345678 EquiEquiuiuuuiiiiuiuuiuuiiuuuiuuuiuuu p Nppp Np. Npp Np NNNNNNp NNNNNNNNNp. NNNNp. Np. NNNNNNNNpppppp NNNNNp Nppp Nppppppp Np NNNNppppppppppp NNNNNNNNppppppppp NNNNNNNNNpppppp NNNNNNNNNNNppppp NN. NNNNNNNNN. o.:o.:o ::oooooooooooooooooooooooooooooooooo :ooooooooooooooooooooooooooooooo 1231234 45678 5678 5675678 5675678 5678666667875678788678678886788678 5678 5565556766667767777678778 567887888678678 555556786786787778 56777778777788678 5678 556755678 567777777777778878678 5555567566677777777777888888888 56755556666777777775678888888 5555556666666786677777788678888888 5555555556666666666777788888888 5555556566666678678678888 5555556666666788888888 5678 55656786786786 1111112121234 123422222234 1234 1234 123444234 111112222211111122222211112211111221111112321222222334 1231111112322123232222221223342312333111112222222222233233333334444 12311111234222222234233333334444 11112222222333334444 1231 Poweooweoweweeeweeeeeeeeeeeeeer: 9r: 9r:::r:r 9999999999r: 9r: 9r: 9999999999r:r: 9: 999999999999999999rrrr 9999999999r: 9rrrr::: 999999999999rrrrr:r:::: 9999999r: 9rrrr::: 999999rrrr:::: 99r: 99999rr:::: 999999V 36V-36V 36V 3VV-3666V-36V 36VVVVVVVV 36V-36VVVVVVV 36666666666V-36V 36VVVVVVVVVVVVVV 36V-366666666666V 36V 36VVVVVVVVVV 3666V 36666VVVVVVVVVVVV-36666666VVVVVVV 666366666VVVVVVVVVVV 33V-3666666666V 36V-36VVVVVVVVVVV 33333666666666VVVV 36V 36VVV 36333666666V 36VVVVVVVVV 33336666666VVVVV--3-36366666VVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVV VVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVV nnnonononooononnnnnnnooooooonnnnnnooooooonnnnnoooooonnnnoooonnnnnoooonnonooomiimiminannnminanaaaanammimi aaiminnimiinammmmmmi aaammmmmmii aaaaaaaaaammmmiiinaaaaaaaaaannaaaaaannnanaaaaaannnannnaaaaaaal /lll /////ll ////lll ///llllllllll //llllll /l / //// 3A m3333333A m3A mAAAA m3A m3A mmmmmmm3A m333AAAAAAAAA3A mA m333AAAAAAAAAA3333AAAAAAAAAAAAAAAAAA mmmm3AAAAA mmmmm33AAAAAAAA mmmm33AAAAAAA mmmmm33333AAAAAAAA mmmmmm33A m33333AAAAAAAAAA mmmmmax.axxaxaxaxxaaaaaxxxxxxxxxxaaaaaaxaaxxxxxxxxxaxaaaaaaaxxxxxxxxxaxaaaaaaxxxxxxxxaaaaaaxxxxxxxaaaaaxxxxxx Power: 9V-36V nominal / 3A max. Leiceee ca Gea Ga Gaaaa Ga GeGeGGGGeGeeGea GGeGGGGGGeGGGea GGGGeeGeGea GGGGGeGGGGGGGGeGeeGeGGGGGGGGeeGeeGeeGeGGGGGGGGGGGGGGGGa GeeeGeGa GGGGGeGa Gea GeGeea GGGGGeGeGGeeeeeeeaaa GGGGGGeeeeeeeeGeaaaaa Geaa GeGeGGGGGGeeeeeeaaaaaaa GGeGGGGGeeeeeeeaaaaaaaaa GGGGeGGGeeeeeaaaaaaa GeGGGGGGGeeeeeaa GeGGGeosyosysosysosysosysosyysosysosyosysosysysosysosyysyosoooooosssssosyssysyyyyyyssssssssssosysoosyosysooosysssssyyysysyyysssysysssysoooooosyssssssyssysosysyyyyyyysssysosyssssosyosysooossssyyyyyyyyssssssssoooooooosssssyyyyyyyysssssssosyssosyooooooosssssysyyyyyyssssssoooooooosyssssyysyyyyssssssosyoo ysssyyyyyyyyyyyyyyyyyyyyyyyyy temsmeemmememssemtemtteemms temsmsmmmmmmmmmmmmmmmm AGAGGGAAGAGAGGGGGGGGGGGGAGAAAAAAGAAAAAAGGAGGGGGAGAGGGAAAAAGAAAAAGGGGGGAGGGAGGGAAAAAAAAAAAAAGGGAGGGGGAAAAAAAAAAAGGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGGGGGAAAAAAAAAAAGGGGGGGGAAAAAAAAAAGGGGGGGGGGAAAAGAAAGAGG temems tems ttttteeeemsmsmems temmsmtememss t msemsms tttttemseeems temsems temsmtemsmsems ttttteeememsemss tttteeemsmms ttemsemseemmmmmmmmmmmssssssss tttteeemsemmmmmmmmmmmmmmtemsssssss tteeeeeemeeemmmmmmmmmsssss ttttttemseeeeemmmmmmmmsss ttttteeeeeemmmmmmmmsssss tttteeteeeemmmmmmmtemsssssss tttemseemeemmmmmmmsssss temtems Leica Geosystems AG CH-9435 Heerbrugg CH-9H-9H-99999999999999999999999999999999999999999999999999999999999999999999999999999999435434435435 HeeHeeHeerHHHHHHHHHeHeerHeHeeeeHeeHeeeeHHeeHeerrHHHHHHHHHeerHeeeHHHHHHHHHeHeeeHeeeHHHHHeHHeeeeHeeHHHHHHHHeHeeeeeeeHeHeeeHeeHeeeeeeeerHHeHHHHHHHeeeeeeeeHeereeeerrrHHHHHHHHHHHHeHeeeeeeeHeeeeeeHeeHeeHHHHHHHHHHeeeeeeeeHHHHHHHHHHeeeeeeeeeeeeeeeeHHeerHHHHHeeeeeeeeeeeeeeeerHHHeeeeeeeeeeeeeerHHeeeeeeeeeeeeeeeerrHHeeeeeeeeeerrHeereeeeeeerbbbbbbbbrugbrugubrurubrugbrugbbbbbbbruguuggbbbbbbbrrbrugbruggbrugbbbbbbbbrbruguggbbbrbrugbrugbbbrrrrrruuuuuuuuuugggggggbbbrugbrugbbrrrrruuuuuuuugggggggbbrrrrruguguuuuuugggrrrrruuuuuugggrrruuuuuuuuruggggbrugrrrruuuuuuugggggggbrrurruuuuuuuuggggggbbbrrrrruuuuuuugggggggbbbbbrugbrugrruuuggggguggbrugrrugggggggggggggggggggggggggggggggggggggggggggggggggggggg 43544444435333333354355555543543544444433333335555554354444443333335355555554444433335333555555555444443333333355555543434444443533333555555543544444333355555435444 555554444 555444 55555444335555544443354343544333554 Manufactured: 20XX ManuMMM nunuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuunuuuuuuunuuuuuuManuMMMMMMMMMMMMM facturedureduuuureddrerededdddddddureduuuuredredureddddddddddeduuurredreureeedededdddddduuuuredredururreeedeeeredddddreredreeeeeeeeeredrededdrrrreeeeeeeedrerrreeeeedduurrrrrredredeeeeedduuurrrrrredeeedddddureuuuurrredeeeeeeedddddddduuuuuurrreeeeeeedddddddduuuuurrredeeeeeedeeddddddddduuuuureuuuurrrreeeeeeeedddduuuuurredrreeeeddddred: 2020222222222022000000020: 20:: 22022222202220000000002022222220000: 200000: 2222000000022200: 20200000022220000000000: 20000000: 0000020020:: 00000000::: 220000000:: 20000000::: 22222200000000020: 222220000000::: 220220000000XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX ffact fact factcfaafact ffact fact ffffaaaacfact fffffacttttt ffffacactt ffffafacttt fffact faactccactt fffaaaaaaaaccct ffaaaact fffaaaaaaaa t ffffaaaafactaa ttt fffaaaactaaaaa tttt ffaaaaaaaaaa tttt ffffaaaaaaaaaaccttt fffaaaaaaaaccfacccctttt ffaaaaaaaaaccccccctt Madededeedeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeee ininininininiininininiiiniiniinnnnnnniiinnnnnnnninnnnnnnnnnininnnnnnnninnnnniiininnnnnnniniiinnnnnnnniiinnnnnnnnniiinnnnnnnnnniiinnnnnnnnninnnnnnnninnin SSwiSwitSwitSwitSwitSwSwitSSSSSSwiSSwiiiitSSSSSSSS itSwiiitSSSSSSSSSwSSwwwwSwiwSwiiitSwititSSSSSSSSSSSwwwwiiittwitSSSwitSSSSSSSSwwww tttwitSSSSSSSSSwwitttwitSSSSSSSSSSSwwwSwittttSSSSSSSSSSwwwSSSSSSSSwwSSSSSSSSSwSSSSSSSSSSwSSSSSSSwSSSSSSSSw ttSSSSSSSSSwww tttSSSSSSSSwwwwww tttSwitSwitSwSSSwitw zerlzerlzerzerzerlzerzeerlerlzerlzerlzezeerlzerzerlzerzerllllzerlerlllzerzeeerlrlerzererlllrlerrerlerllzzzzzzeerleeeerrrerrerllzzzzzzzeeezerleeerrrrrrrlrlzzzzeeeeerleeeeerrrrrrrlzzeeeeeeeerlerrrrrrrlzzeeeeeeeeeeerrrrrrrllzzzzeeeeeeeerrrrrrzzzzeeeeeerrrrrrrlzzzzzzzzeeeeeeererrrrlzzzzzzzzeeeeerrrrrzzzzzzzeeeeeerrrrzzzzzeeeerrrrzerlzzer anndandaandandandandanaaaandandandandandnddddddddandnnddddddndandnnddddddddandanandndddddandddddannnnandnndddanddddddnnnnndnnddndddddndnnnnndddddddddnnnnnnddddddddnnnnnddddndanddnnnddddddddnnnndddddaaannnandnndddndddddaaaaaaannnnnnnnndddddddddaaaaannnnnnndddddddaaaaaaannnnnddddddaandn Made in Switzerland FCC ID: RFD-ICG80NG FCCFCCFFFFFFCFFFCCCCCFFFFFFCFFFFCCCCCFFFFFFFFFFFCCCCCFFFFFFFFFFFCCCCCFFFFFFFFFFFCCCCCFFCFFFFFFFCCFFFFFFFFFFCCCFFFC IDIDIIIDIDDDIDDDDDDDIIDIDDDDDDDDDIIDDDDDDDDDDDIDDDDDDDDDDDIDDDDDDDIDDDDDDDDDDDDDDDDDDDDDDDDDDDIIDDDIIIDDDDIDIIDDIDDDIDIIDDDDDDDIIDDDDDDDDIIDDDDDDDDDDDIDDDDDDDDDDDD: RR: RRR: RRR: RR: RRR: R: R: RRRRRRR:: R: R:: RRR: R:: RRRR::: R: RRRRRR::: RRRRRRRRRR::: RRRRRRRR: R: R:: RRRRRRRR::: RRRRRRRR: R: RRRRRRRRRRRRRRRRRRRRRRFD-FD-FDFDFFFFDFFFFFD-FD-FDDFD-FDD-FFDDDDDDDDDDDDFD-FDDDDDDDDDDFDFDD-DDDFDDDDDDDDDDDDDDFFDDDDDDDDDFFFFDDDDDDDDFFFFFFDDDDDDFDFFFFFFFDDDDD-FFFFFDDDFFFDFDDDDDDDDDFFFFFFDDDDDDDDDDDDFFFFDDDDDDDDDDD ICGICIIICICGICCGCCCGCCCICGGGCGCGGICGCCCCCICGICGCGCGGICCGCCCCCCCCGGGGGCGICCCCCCCCCCGGGGGCGICGIICCCCCCCCCGCGGGGGCGICCCCCCCCGICCCCCCCCICGCCCCCICCCCCCCCCCICGIICCCCCGGGGIIICGCCCCCCCCGGGGIIIICCCCCCCCGGGGGIIICCCCCCCCCGICGGICGCCCGCGGGGIIICGGGGGGGGGIIICGGGGGGGGGGGCGICGIII GGGGGGGGGGGGGGGGGG80N80N80NN880N80N80000808880NN888880N80NNN80N80N80NNNN80N88880N80N80NNNN0NN0NN88880NN888 NN88800N80N888088000N08888888000NNN0N80NN0N88880N888000NNNNNN88880NN80NNNN88880NNNNNNNN88888800NNNNN0NNNNNNNN88888000NNNNNNNNNN80N880N88000NNNNNNNN88880N0000NNNNNN80N88800NNN880N00NNNN80N8880000NNNNNNNNN88888800000NNNNNNNN88888880000000 GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG IC: 3177A-ICG80NG CICIICCCCCCCCCCCICIC:
IIICCCCCCCCCCIIICCCCCCCCIIICCCCCCCCCCCIIICCCCCCCCCCIIICCICCCCCCCCIIICCCCCCCCCCIIICCCCCCCCIIICCCCCCCCCCIICCCCC 31111111111111111177A777A77777A77A77A77777A777777A77A7AAA77AA77777777A77A7777A777777A7AAA7777777A7AA77A77777A77AAAAA77777AAAA777 AAA777777A7777777A77777777AAAAA7777777777AAAA7777777777777777AAAAAAAA77A77777777777AAAAAA7777777777AAAAA77777777AAAAA7777A777AA7777 AA-IC-IC-II-I-IC-ICCCCCIC-IC-IIIICCCCC-IIC-ICCCC-ICICCCCC-ICIICCCCCCC- CCCCCCCCC-ICCCC-ICCCCC---- CCCCC----IIICCC--IIICCC-IIICCCCICICCCG80G8GGGG8GG80GG8GG8888G8080000G80G80G800G8GGGGG80G8GGG8088880G800G80G80GGGGGGGGG88G800G8GGGGG80GGGG8888800G8GGGGGG8888G88G80G8GGGGGGG8888G8888800G80G8000G80GGGGGGGG888888880G800GGGGGGGGG88888888000GGGGGGGGG8888G888880G800GGGGGGG8888GGGGGG888800GGGGGG88888000G80GGGGGGGG88000GGGGGG880000G80G80GGGG8880GG NNGNGNGNGNGNNGNGNGGGGGNNGNGNGNGNGNGGNGGNGNNGGGNGNGGGNGNGNGNGGGGGNGGGGGNGGGGGNGGGGGGGNGGNNGGGGGGNGGGGNGNNNGGGGGGGGGNNNNGGNGNGGGNNNNGGGGGGGGNGNNNNNNNNNGGGGGGGGGGGGGGNNNNNNNNNGGGGGGGGGGGGNNNNNNNNNGGGGGGGGGNNNNNNNNGGGGGGGGGNGNGNNGGGGGGGGG Contains transmitter module:
raransaaaansmaaa sssmmmmmmmmitter ransm insn tttttttnnss ttttttnnnnsnssssssss ttttttnnnnnnnnsssssssss ttttttnnnnnnnnsss tsssss tttttnnnnnnnnsssssss tttttnnns tnnnnnssnsssss ttttnsnnnnsnss tss tttns tns tsnnnnssss ttttnnnnnnsssss ttttraansmnansansm ins t ins tnsns ns tnsins nnss ts s tttttt ransm ransm raraansmansmsansmmnsm ransm rrrrrrraraaaraaaaannnnnnnnsssssssnsmsmmmmmmsmnsmsm rrrrrraraaaaaaannnnnnnnnsssssmsss ransmmmmmmmmmmansm ransssmmmmmmmmm rrrrrrraraaaaaaaannnnnnnnnsssssmsssmmmmmmmm rrrrrraraaaaaannnnnnnsssssssssmmmmmmmmm ranraransm rrrransm rraranaaansmannsnsnsss ransm ransmm ransm ransmansmansm raaaaaaa smssmmmmmmmmm rrans rrrans raraaanaaaannnnnnnsnssss itterttitter ittetteer iiiiitttitter itteitterter iiiiiittttttttttttteitteitter iiiitttttttttttttetter itteiiitter tttttttterttttterterer iiiittttttttteeeeeeeeerrrrrter iiitteittttttteeeeeereerrrrrrr iiiiittttttteeeeeeeerrrrrrrr iiiitttttitterttterteeeeeeeerrrrrrr iiiiitttttttttteeeeereeerrrrr iiiiitttter ttettertttteeeeeerrrterrteeeerrrrrtteeeerrrrr o um umoduddumodmmodumodddddddddddumodmoodudddddddddddumodududdddddddddmodumodumoduodudodumodddddddodumodmmmmmmommmmmmmoooooodddmodddodmoduddoduuuuuuuuummmmmmmmmmmmmoomooooddddddoduddduduuuummmmmmmmmmmmomoooooddddddoddduuuuuuuuummmmmmmmmmmmmmoooodooodmododdddmodddduuuuuuuummmmmmmmmmmmooooooddddddddduuuduuuumomodummmodumommodummodmodumooomodddudddumodumodumodumodumodumodmodmmmmmmodmmmmoooodddduuummmmmmmmmmoduooodduuule:le:elele:lllelllllle:llllllele:le:lllllele:lllleeee:le::::llllleeele::::lllleeee:::::llleee:::::lllleeeee::::le:le:leee::e:eleeeeeeee::eeeeeee::
Conta CoCCCCCCoCCCCCCoooooCoCCCoCCCCCCCoooooCCoCoCoCCCCoooCoCoCCCCCCoCoooooooCCCCCCCCCooooooooCoCCCCCCoooooooCoCCCCCCoooooCoCCCooooCCCCoooCooCCCoooCoCCCoooo FCC-ID: N7NMC7304 FCFCFCFCFFCCCFCCCCFFCFFFFFFCCCCCFFCFFFFFFFFCCCCCCCFFFFFFFFCCCCCCCCFFFFFFFCCCCCFFFFFFFFCCCCCCFFFCFFFFFCCCFFFFFFFCCCCCFFCCFCCCCCCFCC -ID-ID-ID-IDIDDDDIDDIIDDDDDID-IDDDDDDDDDIID-IDDDDDDDDIDDDDDIIIDDDDDDIDIIIDDDDDDDDIIIDDIIIDDDDDDDDDDDIDIDDDDDDDDDIDD-IDDDDDDDDDDDDDDDDIDDDDDDDDDDDIDDDIDDDDDDDD:: N: NN: N: N:: NN: NNNNN: N: NNNN: N: N: NNNN: NNNN: NNNNNNNNNN::: NNNNNNNN: NNNNNNNN:: NNNNNNN: NNNNNNN: NNNNNN: NNNNNNNNNNNNNNNNNNNNNN7NM7NM7NM7NM77NM7N7N7NM777NMM77N7N7NMNNNNNMNM7NMNM7NMMMMMMNNNNN7NMMMMMMMM7NM7NM7NNNNNMMMMMNMMMNNNNMMMMMMMNNNNMMMMMMMMNNNNMMM7NMNM7777NNNM7N77NN7NM77NMNNNNM7NNNNNNNMN7NNNNNNNNMNNNNNNNNNNN7NM7NNNNNNNNNM7777NM7NNNNNNNMMMMM777NM7NNNNNMNMM77NNNMMMM77NNNNNNNMMMMMMMMC73C73CCCCCC73CCC73C777C73C733333C73373C73C777777373C73777C7377773C73C73C77C77777C733CC73C77777373CCC7CCCC77777733733CCCCCC7773337333CCCC7C73CC777333333CCCCCCC7C73C 333333CCCCCCC73CC 3333CCCCCC73CC 33333CCC73CCC73CCCC733333CCCCCCCC73333CCCCCCCCC777333CCCCCCCC7C73333CCCCCCC7773333CCCCCC777333C73C7C73773333CCCC7773333330004040404000004004440444444040000040044444440400000000044444444000000000444444000000000440444444000000000044444400000000000440000000000440400000000044444000000000000000004444040000000000444444000004444444000000444440000004444044400040000044444040004044400000400444444 IC: 2417C-MC7304 IIICICCCCCCCCCCCCIC:
IIICCCCCCCCCCIIICCCCCCCIIICCCCCCCICICCCCCICCCCCCCCCCCCCICCCCCCCIIICCCCCCCCICCCCCCCIICCCCCCCCCICIICCCCCCC 244444444444444444444444417C17C11111777717C17C17CCCCCCCCC111117C17C17C7717717C77717CCCCC1117C7777C7C777717CCCC111177777717CCCC1117C7C7C7C777C117C1777717CC111717CC11 CCCC7C17CCCC11177CCC11117777CCCCC1711177CCC1111117C777CCCCC1111117777CCCCCCC1111177CCCCCC17CC111777CCCCCC17C7C7C777 -MC-MC-MC-MCMMMCMC-MC-MCMCMMMMMM-M-MC-MCCCCCCCCMCCCMMM-MC-MCMMMMMMCCCCMC-MCMCCCCMMMMCMMMMMM-MCCCCMCMCCCMMMMMMMMMCCCCC-MCMCCCCMMMMMMMMMMCCCCCCCC-MCMCMMMCCMCCCCC-MCMMMCCCCCCCMCMMMCCCCMMMMCCCCMCCCCMCMMMMMCCCCCC-----MMMMMCCCCMCCCC---MMMMMCCCCCC--MCMMMMMCCCCCCC---MMCCCMMCCCMMMMMMCCCMMCCC7777777730777730730300007307300077777773030000730000773073077773030000000777730000073000077300007300000000073000000000000033333337300000000003073333337333000000000077307773333333300000000077377733333333000000007777777330330330000000077777777 000000307777777777 000007777777777 000000777777 0000077777 0004444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444 0005679 05679705679 05679 0560505679 0005679 56795056796679679779776799 05679 00050500567505679 567956666666777056799999999 000005679 0005679 0567056755555556796666677705677999999 0500567056050005679 5555655566660567977776797999 000000567555656679677777999 0000567556755666666677777056799 00005556666666675677677567999966666677777999 0555666677777999_00400040040040000400000_004044004004000000440400444_00400004000400_0000044_004444400000000040040044444400000040404444004 _000000000000_004444400040000_00444440000___0000000444___ 005679_004 005690_001 This device complies with part 15 of the FCC Rules. eeee f ththeheee FCC CCCFCC CCCFCCFCCCCCCFCFCCCCCCFCCCFCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCFFFFCCFCCFCCFCCCCCCCCCCCCCCCFCCCCCFFFFCCFFFFFCCCCCCCCCCCCCCCCCCFCCFFFFFFFFCFFCCCCFCCCCCCCCCCCCCCCC devic This hh s devdedevic f the dddeeevvice come come coe comcoooome coe comoe coocomee ccome cocomcome comomomoe come comeeeee comcomcomcomcccccomcomoocomoommmmmcomeeeeeeee coe comcomcocomcccccomcomcoooooooomommmmmmmme commcommmeeeeeeee comcomccccccomccoooooooome coommmmmmmmmmmmmmeeeeeee cccccccome cooooooomcommmmmmmmmcommeeeee comeee comcccccccccooooe coommmmmmeeeee ccccccooooommmmmmme comeee comccccccoooooommmmmmmme comeeeeee comccocccccomooommmmmmmmee comeeeee ccccccoommmmmmme comeeeeee comccoommmmmmpliespliesplpliespliesplipliesliesllielieeiesesiesspliessplieplipliellipliipliesplieeeeeeeplieessssssessplipplippllliiieeeeeeeeessssssssppliesppllliiieeeeeeeeeessssssspppliesieeeeeeeessssssplpppp eeeeeeepliesssssspliespp iieeesssplliiieeeeeeessspppllliiieeeeeeeepll eeeeeesssssiesss withw thwithwitwithithithwiwiwiththwititiitwithtttthiiittwithwwwithwithwwwithwiwitwiwithhhhwwwitwwwwithwithwithwwitiithwitiththhhhhhwithwwwwwwwithwwwwwitww twitthhhhhhhwithwwwwwwiwwwwwiww ttthtthhhhhhhhthwwwwwwwwwww tttthhhhhhhhwithwwwwwww ttthhhhhhwwwwww tthhwiththwwwwwww thhhwithhhhwwwwwwwwww twithhhhhhhwwwwwwwwitthhhhhwwwwithhh partpartarrrttrttparttrtrttttpartpaparparttttttppppaaraaaaparaarrrttttttppapapppaaaaaaaaaarrrarrrttttpppppaaaaaaaaaarrrrrttttttppartpppaaaaaaaaaarrrrttttartppapaaaaaaaaaarrttttrtpppappaaaaaaaartartppppartaaaaartaaarttppparaaaaaaaaartppaaaaaaaaarrttttttppaaaaarttttt 15 o15 o11515 1515 o11515 o15 55 o55 o5 oooooooo15 o11151155 5555555 ooooooooo11115555555 o55 o5 oo5 oooooooo1115155555 ooooooo1511115555555 oooooo1155555 oooooooo15 o555 ooooooo55555 oo15 oooooo5555555 oooooooo11115555 o55 oooo1115 o5555 oooof the FCCFFFFFFFCCFFCCCCCCC CCFCCCCCCCCCCCCFFFFFFFFCCCCCCCCCCCCCCCFFFFFFCCCCCCCCFFFCCFFFFFFCCCCCFFFFFFFFFFCCCCCFFFFFFFCCCCCCCCCFFCCCCCCCC RulesRulesRulesulesuleRulesRulesRuleulesulesRulesleRuleleslesRuR lllesesllessRulesRulesRulRRulellesllRuleelesRRRulesRuRullleeeeeessssRulesRulesRulessRRRRulesRuuuuulellleesulelesssRulesRRRRRRRuuuuuuuulellleesssRulesRRRRRulRuuuuleuuuRulessRRRRRuuRuulleessRRRRR lllRuleseessRulesRR llleseeesessesRRRRulleeseeeeesessssRRRRRulleseeeesssssRuleessseesesessss....... ddddevicevidevvvicvievic dddddddddevvic devdevvic ddevddddddevdeeedevic ddddeeeeviceeeeevicvvdevicvvvidevicvic devdeeeeeeeevvvdevvvicvvviiivicccevicceeeeeeeeeevvvvvevdevvviivicceeeeviceeeevvvvvvviiicccceeeviceeeevvvvicvvvvviiccceevicevvviiiviccceevevviiicc devvvvviiccccevvvviiieviccccc deeeeevvvviiccc f the f ththehe f the f the f thethehe f thhhe f the f hehhhthhf thf the f the ff hhhhhf the f the fffff thhhhheeeeeetheee fffffff thhhhhhhf theeeeeeeeee fffff the ff hhhhhf theeeeeeeee ffff thf hhheeeeeeeee fff thhheeee f hheeeeeeee f theeeeeeeee ff thetheeeee eeee f f hhe foeee fffffollowi he fo tttttooo tthe fo to t jecjjecteecccttt to t bject iissss sssssuuubject is sus sus sss ss ssss s ss ss ss susu ttiioooooooontiottiiooooonnnnn s su Operation is subject to the following two conditions:
OperaOO eraraaarararaaaararraaaaaaaaarrraraaaaaaararrraaaaarrrraaaaarrraarrrraaarrrraaaarrraaaaraaaraaaaaaaaaraaaaaaraaaaaaaation o o o cccccooonnnnditioditioditiodididitditioditiodddiitiottioditioitiooootioddditioditiodddditioiitiottttioitioooootioditioditioddditddddiditioitioitioitttt otiooooooodddddddddiidittttiooitiooooooditiooodddddddditttttioooditiooooooditioddddddddditioitttttioooditioodddddddd tiottt ooooooddddddddititdittttditioooooooodddddditioitioittitiooooooooddddditioiitiotttt oooooodiit oooons:ns:nsnnnnsnsnns:sssssssnsnnsnnnnssssssss::nns:nnnnnnsnnssssssss:nnsnnsnnnsnssssssssns::nnnnnnnsssssss::ns:nnnnnsssssss:ns:nnnnns:nnnnnn ::nnnnnnnn ::nnnnnnnsss::ns:nnnnnnsssssss tion tiontiontion tiontiontiottiontiontiotiontiotiionononoootionnnnnntiotttiotttioiitiootion onoonoonnnnnnnttttttiiotionoionoooooonnnnnnnnnttttttiitiooooooooooonnnnnnntiontittttiooooooooooonnnnnnnion tt oooooooooonnnnntttttioooooooonnnnnnttiottttionioooooooonnonttttioiooooooonntion o coo coco con o con o conccconooonn o connn o con o cooo con o co coo con o concconccccoooo conononnnn o connn oo coooooooo cconcccccoooo connnnnnnnn ooooo co cooo cccccccooonnnnnnnnn ooo coo con o coo conccccccoooonnnnnnnnnn oo con ooo o coccccccooonnnnnnnn o oo ccccocoonnnnccccoonnnnn o cocccccccoooonnconnnnn oo ccccccoooonnnnnnn twng twng twwng twng tng twg tg tng nng twg ngggng twng twnggng twgngng twng twnngng tnng tggggng ttttnng tnnnng tnng tg twgg ttwtttng twwwwtwwwng twwwwwnnngng tnng tnngggng twtttttwwwg twwwwwwng twwwwnnnng twnnnngg twgg twtwtttwwwwwwwwwwwwnnnnnngggngng ttttwwwwwwwwwwwwwnnnng twng tnggng twttwwwwwng twwwwwwwwwnnng twnngg tg tttwwg twwwwwwwwwwwwnnng twng tttwwwwwng twwwwwwwwnnnnnng tnggg tttttwwwwwwwwwnnnnng tng ttttwwwwwwwwng twnnng tggg ttwwwwo cooo co cooo con is siss sssssss ss sssssu is sissssss ss sussussss suuuuuuu iis sss sssssss ssssssssss ssuuuuuuuu iiss ssssss ssssssussuusus suuuuuu iis sssssss ssusssuuusuuuuu iisss ssssuusu iisss ssssu iisss ssssssuu iisssssss sssssssu iissssssss ssssssu bjbject bjecbbbjecbject bject bbbbbbbbjebjecbjjjececeecteejeccjececjecttctct bbbbjejjecjjeceeecbjecccececcttttt bbbjecbbjjjjjeceeecccccecccctttt bbbbbjjjjjeceeecbjeeccccccctct jjjj ccccccbbjjjjecteccecccjecjeeeeeccccccccttt bjjjjeeeeeccccccctttttt bjjjjjeeeecccccccctttttt jjecjeeecctccccctttt bbbject to to t toto t toto t to t ttotoo t tototototto to t totottto t to to to to ttt totottttoooo too tttt tototttttoooo tototo o ttttto t totttttoootoooo ttttt ttooooooo ttttt ttotto toooooo tttt toooooo tooo t tttttooooo ttttt ttttooooo tttt he fhe foe fofhe fe foe fo he foe fhee foe fofhhe fhe fo hhe eeeee ffhe foo hhhe he fhe fo hhhe feeeee ffffooofo he fo he fhhe fhhe fo he fhe fheeeee fofffffo he fooo hhe fo hhe fo he fo hhhheee foe foe foffffhe fffooo hhhhhhheeee ffffffe fooo hhheeee fffooooo hhhhhee ffffoo hhhe fhehhhe ffffofooooo hhhhhheeee fffffoooo hhhhe fo hhheeee fffffoooo he fhe fhhe fo he fo llowiwllowi llollowlowlowiolowllowi lllowllowlllllowii lllowloo ii llllolloooooowowiii llllllooooooowwwwwwwwwiwi llloowoooooowowwwwwwwwowii llllloooooooowwwwwwwwowii lllloooooooowwwwwwwwii ll ooooooowwwwwwwwwii l owwwwwl oowoowwwwwwi llowlloowwwwwwwwwlllllooowwwwwwwwi lllooowwwwii terfe ul inul inul iul inul inul inuuul inul inul inul inuuuul inl inul ininnuuuuuul il il innnnninninuuul inuuul iul inl inil innnninnnnul inuul inuullll iniiinnnnnnninuuuul inul inll iul iiinnnl innul inuul inull iinl iiiinnll iinll iiul ul inul inul iinnuuuu nnnoooottt cccccccooooo ccccause harmf ause usauseauseuseuse sseeauseause evice
(1) T1 This dhis dhis his dhishihis diihis s dhis dddddddhis dhis dhhhhisiihishisis dddddddhishhis dhhiiissssshishis ddddddddddhishhhishhiiisss dhis dds ddddhishhhhhiiihisshissis dddddhhhhis diiisshis ddddhhhhiiissss ds dhhhhissshis hhhhhisissshh sh dhiiss ddhhhiiss dddsss dddevice tteeeeeerferrrrrfffffffeeeee eee eeee eerence aaauuuuusssssseee harmf not c eee may maymaymaymaymamaaamaymay mmaymaymaymaamayaaaymayymaymaymammaymmammaymmaaayaaaayyymaymmmmmmmmammammmmaaaaaaay yyymayymmmmmmmmmmmmmmamaaaaaaaaayyyyyyyyyymmmmmmmmmmmmaaaaayyyyyyyyymmmmmmmmmmmamaaaaaayyyyyyay maymmmmmmmmmaayyyyyymmmaymaymmmmmmaaaaayyyyyymmmmmmmmaaaaayayyyyyyyymmmammmmmmaaaaayyyyyyy ayaaaayyyyy not c rence rence rence rence enccencecee rerr ncece rence rrrereenenceeeeeece rrrrenrence ence ence enceennncceeeeence ence rrrereeeeencencence eennncenncccececeeeeeeee rerrrerenrreeneeeeeeeeennncennnnnnccecencencccccceeeeeeee rererrreeeeeeeeneennnncennnncccccccccceeeeeencee eeeeeeeennncennnnnccccccccceeeee rreeennnnnnnncccccccceeee eeennnnccncecccee ennnnnnceccce rerer nnnnnnncccccceeee reeence eennnnnncncccceeee eeee ccceccccee, and
, and
, and
, and
, anand
, and aananandanndand
, andaaanananaaandaaaannnndnndddandandandananaaaaaaaannnnnnnd
, andddandandddandanandaaanaaaaaaannnannnnndddd
, anddandddaaaaaaaannnnnnnddddanddd
, anaaaaaaannnnnnnndddddddddaaaaaannnnndd
, aannnnddd
,, a, anaaaaannn anndddd
, a anaaaaaannnnndddddd
, a,, aaa ddd eeeee evicevievievicevice eveviceviceevice evevievice evicevicevvicce eeeeev eecee evice eeveeveeevicevvvicviceice eviceeeee eeevice eeeeevievvicvvviiceeeee eeeeeeveevicevvvvvvicevviceiiceccceeeeeeevicece eeeevice eeevvvvvvvicevviiievicecceeeeeeee eeeeeevvvvvvvviicccceeeeeeevice eeviceeevvviiceicceeeeeeeee eeeevviicceeeeevvviceievicccceeceeeeeevvvviiicceeeee eeeeevvvvviceiicevicceeeee not c not cotoot cototnot ct cot cot c nnotnnonotooooooonotttt ccccct c not ccc nnnnoot coooot ot ooot ctottttt cccccot ccot ccc not c nnnnotooooootooootttnott ccccc not ccot ccc nnnoooonoooot cotttttt cct ccccccc nnnnooooooot ctttt cot cccct ccc nnootttttt cct ccccot cctttttt ccccccc nnooott cot cot ccccot c aausususeusssseuseuseaaaaauuuuuseusssssssseeseeaaaaauuuuuuussssssssseeeeuseuse aausaaauususeauuauuusssssssseeseauseaaauuuuuususuuaussssesseeeeaauseuuuuuuuussussssseeeauussssseuuuusessssseeeauuuussssseeeeaaaausuuuusseee aaaaaaa harmf harmharmharmf harmharmhaharmharmf harmf harmf harmharmhharmaaaraaarharmf harharharmmmmharmmmmmf harmff harmhhhhharmhaaaraaarararrrrrrmmmmharmf hhhhhhhhhaaarmarmaraaarrarrarrmmmmmarmmmmmharmmmmfff hahharmf hhhharmf haaaarrrmharmharmmharmmmmmmharmmmfff harmhhhaaraarrrrmmmmmmmmmmmarmmmmfff hhhhaarmmmmmmmmmmharmhhhaararaaarrmmharmmmmmmmmf hhhharmhaaaaaaaaarrrrmmmmmmmmmmmf harmf hharmf hhhhhaaaahaharmaarmmmmharmmmmmmf terfe terfeerfe terf terfe terferfeerfeferterfeerfeerfe tererrrtererfeeeeerfe terf terf terfeererrfe terfefe tertteteeeeeerrrrrrfffffe tttetteerfeeeerfeeeerrrrterterferfrfffe terttttteeerfeeeeeeerrterf terterfffffe tertttterfeeeeeeeerrfeerfrff tteeeeeerrferrfrrfffeerrrrffffff armf armf armf armmmarmmff renc
(1) This device may not cause harmful interference, and
(2) this device must accept any interference received, eeerrfffff rrence erfer y int pt an eeevviviiccceeeeee mustmustmustmusmuumuuustmumusmumumustmusmumusmustmmmustmuususussttustmmmmmmmmummmmmususuuustuustuusstsssssttmmmmustmmmmustmmmmmmuumuuuuuuussssssstttustmmmmmmmmustmmmmumuuuusuuusssssssstttmmmummmmmmuuuussssssssstttstmmustmmmmmmmmmuuusssssstttmmmmmmmmmustmustuumussssssstmmmmmmmmmuusuuussssstt acceacceacceeeeeaccaccececceeeeaaaaaaaaaaccccecccccccaccecaccceeeeeeeeaaaaaacceaaaaccecccccccaccecccccccccceeeeecceeeeeaaaaaaccaaaaccccccccccccceacccccccccceeeeeeeaaaaaaaaaccccccccccccccceeeeeeeaaaaaaaacccccccccceeeeeeeeeaaaaaacccccccceeeeecccccccceeeeeacccccccccccccceeeeeeept an evice
(2) 222 this dhis dhis dis di dissisis iiss dhiiisssssssss dis dhis ddddis dhisis dissssssss dhis ddddhis disss dssssss dss dddddhhihis dssssssis ds ds ddddhh ssss ds ddhh sssss dddhis dhh ssss ddhhis dssss dsssssh ssssssss ddddevice erfer erfeerferer rfer rfer rrrferfeeer erfereerer erfer erferfeerr eeerfeeeeerfer erfer eereeerfeeerrrrrrffrffeeeeerrrrrrr eeeeereeeerrrrrfffffeeeeeerrrrrrr eeeereeerrererrrffffffeeerfererrrr eeeeeeerferrrrfffferffeeerrrrr eeeeererffffffeerrfer eerffffffeer eeeeeeececceeeeeiiived, ved, ved, vedeedvedvedvvedvedvvveevedvedved,dddvedvvvvedvvvveeeeeeeveddddddveded, vvvvedvvvvvvedeeeeeddddddvvvedvvvvvveeed,dddddvvvvvvvvveeeddddddddvvvvvedeeedddddved,,, vvvvvvveddddddvedd,,, vvvvvedvvv ddddddved,,,,,,, eeennnnnnnccceeeee recei recei receeceecrece rrrerecreereececeeececeeceiccccceeeceieeceee recei recrrreeeeeceeeeceicceccccccceieieeceeceeceeeii rrrrrreceecei eceeeeeeecccccccccceeeeeeeeei recei ecei rece rrrrereeeeeeeecccccccececeeeeeeeeicei rrrrrececeeeeeeeecccccceeeeeeeiii rrrreeeeeeccccceeeeei reeeeeeceeeeii eviceievicevice evice eviceievice evicee eveeveevicevicevvvicceeece eeevevicevicvvvv eeee eveveeeeeevice evieevvvvivvicev eeeee eeeeeeeeeevevvvvvicviceiiviceceeeeeeeece evice eeeeeeeevvevevevvvvviiicceeeeeee eeeeevice eeevevicevvevviiiieviccceeeee eeeevvvvvicevvviiccceeeeeeee eviceevvevvviiiccceeeevvvviiiccce pt an pt apt apt ant apt an pt apt att ant apt apt anaan pt an pt aannn pt an pt apt an ppt an pt at anttt antt aaaanaananannnn pt an ppptttttt aaaaaaaanapt aannnnnnnt ann pppttpt anttpt aapt aaaaaaannnnannnn pptttttt ananaaannnn ppt antttttt aaaaanannnn ppptttt aan pt aanaannnn pppptttttt aaaaaaaannnnnn yyyyyyyyyyyyyyyy ppppppp y int y intny intnt y ininy intnny iny iny int yy intnnnniny int yy int yyyy y iinnnnintt y int y iy iyyy iintnnniny intttt yyyyyyy inyy y int iiintnntttttt yyyyyyyy y iint iiiy innttt y int yyyyyyy iyy iiinnntttt yyyyy iintttttt yyy iiniiintttt yy int yyy iinnnttttt int ence ence encencceencee ence eence eeenceeeeeeee encence eeeencenceeeeee eeneeeeeeennncncenccccceeeeeceee eeeeneenceeeencennnnncenccncccccccceeeeeeeeee eeeeeeeeeeencennnnnnnncenccccccceeeeeeeee eeeneence enceencennnnnncccccceeeeeee eence eeenceeennnnnnncenccccencceeeeee ennnnnnncencccceeeeennnnnnnnceencence including interference that may cause undesired feeeeeeeerrerrrereeneeeennnnnneerrrrrrreeeeeeeennnnnnneerreeeeeennnnnerreeeeeenennnneeennereeerrreeeeeeeennnnnce th feren iiiinnnnntterrrrrferen inclunn luding ddesdddddddeeeeeeeeesssiirrrrrrededdededededededeedeedeeeedddddddeeeedeeeeeeddddddddedeeeeeeeeeeeddddddddeedeeeeededdddeddededdedeeeeddddddeeedddeeddddedddddededdddddd ding ding dddingdingding ng ding ddddidinggggggddddingggddddddingdddininnnnnndingggdingng gdddddiddddiiinnnnnnnng nngggggggddddddddiiiinndinnnnnnnggggggddddddddininidindinngnnnggggddiiinnnnnnng ddiinnnngddinnnniinnnnngngggggddiinnnnnnng nnngggggngg ggggggggggggg inter inter innintnter internnnnninntntenninnnnteininteinteintenterntennnnnnntettterereteinterr inter iinteinnnnnnntetetertetteeeeeeerrrrrrter iiinnnnnninnterttttteeeenteeeeerrrrrr iininnntennninterttttteentertetereeterntererrr iniiinternnintttereeeeerntentererr iniinnteeerr iinntereeerrrrer cceee teee ttttthhhhhhat ma at ma at mat mamat ma at ma t mmmma at maaaa at ma t mmat mmaaa at ma at mammmmaaaaama atat matat mat maaatttt ma tat ma at mt mat mammmmaaaaaamama at ma aaaaaaaaatt ma ttt ma t mammmmmaaaaaaa aaaaaaaaaaat ma ttt mttt mammat mmmmmmt maaaaaaaaama aaaaaaatt mt mmmmmmmaaamaaaa at ma aaaataat mmmmmaaaa aaaaa mmat mmt maaa aaaatttt mammmamaaaaattttt mmmmmmmaaay cau y cau y cau y caucaucaucccay caccccacaucccaau y cy cau y cau y cau y cayy cauccccaaaaay caay cauuuu yy cy cau y cayyyyyy cauccaaaaaaaaauuuuuuu y cyyyyyyy ccy caaaaaaauuuu y cauuuu yy cyyyyyyy ccaaauaaaay cauuu y cauuuu yyyyyy aaaaaaaauuuuuu yy yyyyyyy aaaauuuuuuuu yyyy yyyy caauuuuuuu yyyy cccaauuuu yyyyyyyyyyyyyyyyyyy se un se un se un se une un se un sssse un se sssse une uneeee unuuuuuuse un se uununnunnnnn sssssse un sse se ueeeese uuuuse unuunue uunnnne unnnn ssssssssseeeese uuuuuuunnnnnnnn ssssssssseeeeee un se uuuuuuuunnnnnnnnn sssssse un sseseeeese unuuuuun se unnnn se un sssssssee ee uuunnnnnn sssssssee uuuuuuunnnnn ssssseee unuuuuuuunnnnnndesir desir ddesir desir ddesir desi desieseeeeseesssessdesir desirr desir desir dddddddeseedesesireeesssiirrrr ddddddddesdeeeeeseeeesssssiriir desirrrr dddddeeeedeeeeessssssiesirrrrsir deeeeeeeessssssir dddeeeeeeeessssssesdddddeeeeeeeedesessss rrrr ddddddeeeeeeesirsissirrr ferenerenerenrefereneereeerenrreeerefereneeerreeefereneeeeeereereeerenreren ferenrenreeeeereeeennnen feeeeereerenerenereerenrrereeeeeeenerenenennnn feeereneereeeeeerrrenrreeeeeeeeeennrennnnnn ce th ce th cce th cece th ce th cccccce th cecccccce th ce th ccccccce th cee the te thece the tthttth ce the thh ce tce th ceccccccccee teee thee thtttthhhhhhhe th ceccecce te teeeeee ttthhhhhhh ce th ccccccee teeeeeee thttthtthhhhhhh ce th ccccccceeee teeeee ttttthhhhhhh ce th cceeee tee thee thttttthhh ce thh cccee te teeee ttthhhhh ccceee the tttthhe thh operation. operapperaperaraaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaation. tion. tiontiontiotionttionioonnnnntiontionttionttiiionoonooooonnnnnnnontion. ttttttiiiooooooonoonnnnnnnnnttittttiiiooootioooooonnnnnnnnnntttttiiontioooooooooonnnnnnntion. titttt ooooooooonnnnnn... t ooooooonnnnnonon.. titt ooon.oonn.. Type: CGA60 Art. No.: 805284 Power: 4.5 - 18V DC / 50mA max. Leica Geosystems AG CH-9435 Heerbrugg Made in Canada CGA60 NMCU12345678F S. No.: 12345678 HW Rev: X.XX Manufactured: 20XX P/N:01018920 iCON gps 80, Safety Directions 14 2 2.1 2.1.1 Description Main components, Dual GNSS configu-
ration with internal modem Description of the System System Components General Information The Leica iCON gps 80 instrument and the Leica CGA60 GNSS antenna together with dedicated accessories like the Quick Release Machine Bracket CMB6, a machine computer, or an external radio offers you highest productivity and flexibility. For example, Single GNSS configuration as well as Dual GNSS configuration is possible, but the system also can be used in a Base Station configuration. Two example configurations are shown in the following paragraphs. a b c c d d e f 005698_001 g b h i j k l a) Modem antenna CA26 b) CA22 Magnetic radio antenna mount, 2 x c) CGA60 Robust triple frequency GNSS antenna, 2 x d) CA16 Antenna cable, 10 m, 2 x e) CAN junction box f) CAN cable g) Radio antenna CA12 h) iCG82 Instrument i) j) Quick Release Machine Bracket CMB6 k) Cable for cradle 5Pin M12/open end, Internal modem 5 m l) Machine PC Component iCG82 Instrument Internal modem Quick Release Machine Bracket CMB6 Description To calculate two positions from the computed ranges to all visible GNSS (Global Navigation Satellite System) satellites. CGA60 GNSS Antenna To receive the satellite signals from the GNSS satellites. This Antenna is specified to the high environmental requirements on mining and construction machines. For correction data transfer radios/modems are used. The special Quick Release Machine Bracket CMB6 can be used for a fast withdrawal of the iCON gps 80 instrument. iCON gps 80 needs to be pre-assembled with the left and right clamping rail of the CMB6, while the Quick Release Base Bracket must be installed on the machine. To determine the position of the machine using measure-
ment information from the instrument and GNSS antenna and for an automatic adjustment of the machines hydraulic system. Machine PC iCON gps 80, Description of the System 15 Component CAN junction box Description The components are connected directly to the standard machine junction box and communication cables are connected via the machine's own CAN bus. Main components, Base Station config-
uration a b c d e 005699_001 f g h i j k l a) CGA60 Robust triple frequency GNSS antenna b) GRT246 Carrier c) CTB102 Tribrach d) iCG81 Instrument e) Tripod f) GAT1 Gainflex radio antenna g) GAD33 Arm 15 cm h) GEV120 Antenna cable, 2.8 m 2.8 m i) GEV120 Antenna cable, j) Satel Radio CCD14 k) External battery GEB371 l) MSC1259 Power cable Component iCG81 Instrument Description To calculate a position from the computed ranges to all visible GNSS (Global Navigation Satellite System) satellites. CGA60 GNSS Antenna To receive the satellite signals from the GNSS satellites. This Antenna is specified to the high environmental requirements on mining and construction machines. For long-range data transmission. Satel radio CCD14 Tripod, tribrach, carrier To setup the instrument and GNSS antenna as a Base Station. Satellite channels Depending on the satellite systems and signals configured, a maximum number of 120 channels is allocated. Instrument iCG81/iCG82 Description GPS, GLONASS, BeiDou and Galileo GNSS receiver, triple frequency, code and phase, real-time capable iCON gps 80, Description of the System 16 Special features iCON gps 80 Special features CGA60 Commands for Remote Config iCON gps 80 instruments are equipped with several special features:
Wide supply voltage range of 9 V to 36 V Voltage peak protection and reverse polarity protection Can be mounted on a machine in both the vertical and horizontal orientations Can be used near the sea Brackets for simple mountings Protection caps on connectors Display and keys for status and configuration Versatile connectivity including CAN, Serial RS232, Ethernet and Bluetooth USB host port for data transfer and firmware upgrade Integrated high speed LTE (4G) / HSPA (3.5G) / GPRS (2G) modem for countries without 4G/3G Integrated radio options Single and dual GNSS variants Backwards compatibility: supports external GFU communication devices for cost effective upgrade from legacy Leica systems Robust, compact aluminium housing CGA60 antennas are equipped with several special features:
Can be used near the sea Standard robust 5/8" Whitworth thread Robust TNC connector Future proof four constellation, triple frequency antenna element Robust, compact plastic housing The iCON gps 80 instrument can be communicated:
via the MPI protocol on the serial port P1 and Bluetooth. via the Leica Machine Control CAN Protocol on the CAN ports. via the Leica Machine Control Net Protocol on the Ethernet port, Serial P1 and Blue-
tooth. Documentation for these communication protocols is available on request from the Leica Geosystems representative. iCON gps 80, Description of the System 17 2.1.2 General Power options
2.2 Description Power Concept Use the batteries, chargers and accessories recommended by Leica Geosystems to ensure the correct functionality of the instrument. Power for the instrument is to be supplied externally. Up to two external power supplies can be connected. External power can be supplied by:
9 V to 36 V DC power supply (machine or vehicle) via a converter cable supplied by Leica Geosystems. GEB371 battery connected via a cable. 110 V/240 V AC to 12 V DC power supply unit, supplied by Leica Geosystems.
iCON gps 80 can be powered using the CAN ports as well as the serial port P1.
iCON gps 80 can accept different voltages on the CAN and serial ports, for example one main supply 24 V and one backup supply 12 V. However, the instrument should never be connected with two different CAN input voltages, as this may cause the instrument to power down and can potentially cause damage to the internal electronics. For permanent operations use Uninterruptible Power Supply units as a back-up in a main power failure. Unpacking the Container Available delivery packages:
Delivery box: when a single iCON gps 80 instrument was ordered. Includes the instrument, the printed iCON gps 80 Quick Guide and the USB documentation card. A hard-top container comprising all items for a Single or Dual GNSS configuration. A hard-top container comprising all items for a Base Station setup. iCON gps 80, Description of the System 18 2.2.1 iCON gps 80 Dual GNSS Container CTC4 Container upper shell The large-size CTC4 container comprises all items for the Single and Dual GNSS config-
urations. a b c d e 005678_001 a) CGA60 Robust triple frequency GNSS antenna, 2 x b) Slope Sensor c) CAN cable, 2 x f d g a d) CA22 Magnetic radio antenna mount, 2 x e) Radio antenna CA12 f) CA16 Robust antenna cable, 2 x g) Modem antenna CA26 CTC4 container lower shell Large-size CTC4 container configuration with Machine PC. a b c d e 005677_001 a) iCON gps 80 Instrument b) Left and right clamping rail of the Quick Release Machine Bracket CMB6 c) GFU27 Radio modem f g d) Allen key 2.5 mm e) MS1 Industrial 1 GB USB memory stick f) Manuals & USB documentation card g) Machine PC iCON gps 80, Description of the System 19 2.2.2 iCON gps 80 Base Station Container CCTC3 Container upper shell The large-size CCTC3 container comprises all items for the Base Station setup. a b c d e 005676_001 a) CGA60 Robust triple frequency GNSS antenna b) GAD32 Telescopic rod c) GAT1 Radio antenna d) CA15 Antenna cable, 5 m CCTC3 container lower shell a b c d e f f g h e) MSC1259 Power cable f) GAD33 Arm 15 cm g) GHT36 Base for telescopic rod h) GSZ4-1 Height hook g h i 005675_001 a) iCON gps 80 Instrument b) GFU27 Radio modem c) Allen key 2.5 mm d) MS1 Industrial 1 GB USB memory stick e) CTB102 Tribrach f) GAD34 Adapter antenna to extension g) Manuals & USB documentation card h) GRT246 Carrier i) GAT18 Multiband GSM/UMTS antenna iCON gps 80, Description of the System 20 2.3 Instrument Components iCG81/iCG82 components Front view:
a b c d e 005681_001 Rear view:
a b c 005682_001 Port USB 2.0 P1 (8-pin LEMO 1, female) P2 (8-pin LEMO 1, female) RADIO CAN1, CAN2 ANT1, ANT2 MODEM f g h i j h d e f g h i j a) RS232 port P2 b) Power and status LED, Ambient light sensor c) ON/OFF button d) Display e) Keyboard f) Tripod fastening clip g) Cover for USB port h) Mounting holes i) Carrying handle, optional accessory j) Radio cover, SIM card and slot-in-device compartment a) Support for GFU device b) External radio antenna port c) Primary External GNSS antenna port d) P1 Data/Power port e) CAN1 Data/Power port f) Ethernet port g) CAN2 Data/Power port h) External Modem antenna port i) Grounding screw j) Secondary external GNSS antenna port, iCG82 only Description USB A data port, for data exchange, software updates. Power input, serial interface for data input/output, and PPS. RS232 for connection of an external radio device. For connection of an external radio antenna. Power input and data input/output. CAN ports are connected internally so connection order is not important. GNSS antenna input. ANT1 is always the primary GNSS antenna and ANT2 is always the secondary (heading) GNSS antenna. For connection of an external antenna for the internal 4G modem. iCON gps 80, Description of the System 21 CGA60 components CMB6 components a b 005691_001 a b c c d c e f 005862_002 c a) Whitworth thread, 5/8"
b) Mechanical reference plane c) TNC female connector g c d c c h i e) Carrying handle, optional accessory for iCON gps 80 f) Clamping rail g) Dummy plugs for cable storage h) Quick Release Base Bracket i) Locking bolt for Padlock a) Feed through for Padlock b) Locking bolt c) Mounting screws, for vehicle mounting d) Guiding rail iCON gps 80, Description of the System 22 3 3.1 External power supply only
3.2 Insert and remove the SIM card step-
by-step Using iCON gps 80 Power Supply 9 V to 36 V DC power supply (machine or vehicle) via a converter cable supplied by Leica Geosystems. The iCON gps 80 instrument can be powered via the CAN ports as well as Port 1. A GEB371 battery can also be connected via cable. For permanent operations use Uninterruptible Power Supply units as a back-up in a main power failure. In general, all installation works - including the setting up of a permanent power supply
- must be done by a dedicated installation specialist. Please contact the local selling unit or dealer for further information. Installing a SIM Card 4 5 005737_002 3 1b 6b 2 1a 6a 60 Ncm Step Description
Ensure the instrument is placed in its fixed position or place it onto a stable surface. Loosen the screws of the Radio cover with the supplied Allen key. Remove the Radio cover.
The indents on the Radio cover allow to grip and pull for removal. Orientate the SIM card as illustrated. Insert the SIM card into the card slot and push it in until it locks into place. Place the Radio cover back into position. Tighten the screws of the Radio cover, with maximum 60 Ncm.
Secure the screws with Loctite 243 or a similar product to ensure that the instrument is waterproof. 1. 2. 3. 4. 5. 6.
To remove the SIM card push the card in again, then it pops out and can be removed. iCON gps 80, Using iCON gps 80 23 3.3 Slot-in-Device Internal radios Following internal radios can be used with the instrument:
Radio Satel TA13 Intuicom 900SLR Insert and remove slot-in-device step-
by-step Device CCD7 CCD8 5a 3 5b 4 6 1b 7b 2 1a 7a 60 Ncm 005738_002 Step Description
Ensure the instrument is placed in its fixed position or place it onto a stable surface. Loosen the screws of the Radio cover with the supplied Allen key. Remove the Radio cover. 1. 2.
The indents on the Radio cover allow to grip and pull for removal. 3. 4. 5. 6. 7. Place the slot-in-device into position to the Radio cover. Place the mounting bracket into position. Tighten the screws. Place the Radio cover back into position. Tighten the screws of the Radio cover, with maximum 60 Ncm. that the instrument is waterproof.
Secure the screws with Loctite 243 or a similar product to ensure
For the equipment setup as real-time base station with radio, it's recom-
mended to use an external radio antenna mounted on a second tripod. This increases the height of the radio antenna and therefore maximises radio coverage. Please contact the local selling unit or dealer for further informa-
tion. iCON gps 80, Using iCON gps 80 24 3.4 External Radios Devices fitting into a clip-on-housing Radios fitting into a clip-on-housing Radio Intuicom 1200DL, transceive Pacific Crest PDL, receive Satelline 3AS, transceive Satelline M3-TR1, transceive TFR-300L, receive Clip-on-housing 1200DL GFU15 GFU14 GFU27 no GFU number Pacific Crest radio modems Pacific Crest radio modems must be ordered directly from your local Pacific Crest Office or Representative. PDL receive only modems built into the Leica GFU radio housing with 12.5 or 25 kHz channel spacing within the following frequency bands are available:
410 - 430 MHz 450 - 470 MHz 430 - 450 MHz 223 - 235 MHz
Pacific Crest ADL, transceive, can be used but is not available in a clip-on-
housing. Attach and detach a clip-on-housing step-by-step 3 5b 5a 6 8 4 1 7 9 005861_001 2 Step Description
Ensure the instrument is placed in its fixed position or place it onto a stable surface. Flip the protection cap of port P2 aside. Ensure that the connector on the clip-on-housing fits to port P2 on the instrument front panel. Place the clip-on-housing into position such that the guide rails for the clip-
on-housing on the instrument and the guide rails on the clip-on-housing are aligned. Slide the clip-on-housing towards the instrument front panel to the guide rails on the instrument. Apply slight pressure to the clip-on-housing towards the instrument side and slide the clip-on-housing towards the instrument front panel until the connector is plugged into port P2. 1. 2. 3. 4. 5. iCON gps 80, Using iCON gps 80 25 Step 6. 7. 8. 9. 10. Description On the top side of the clip-on-housing, turn the screw clockwise, as shown by the symbols on the screw, to lock the clip-on-housing to the instrument. Screw the radio antenna or a radio antenna cable onto the clip-on-housing. To detach the clip-on-housing, turn the screw anticlockwise on the top side of the clip-on-housing, as shown by the symbols on the screw, to unlock the clip-on-housing from the instrument. Slide the clip-on-housing away from the instrument front panel until the connector is unplugged from port P2 and the guide rails are released. Place the protection cap on port P2 again. LED indicators Description Each clip-on-housing for a radio or digital cellular phones has Light Emitting Diode indicators on the bottom side. They indicate the basic device status. Diagram a b c d is red a) Mode LED, available for Satelline 3AS and M3-TR1 b) Data transfer LED c) Signal strength LED d) Power LED THEN the device is in the programming mode controlled from the PC via cable. off green or flashing green red or flashing red the communication link, Data data is not being transferred. data is being transferred. Carrier Detection, is okay on the roving instrument. the DCD is not okay. off red or flashing red the communication link, Data off off green Carrier Detection, is okay on the roving instrument. the DCD is not okay. power is off. power is okay. 005936_001 Description of the LEDs on IF the Mode LED GFU14 with Satel-
line 3AS, GFU27 with Satelline M3-
TR1 any device Data transfer LED Signal strength LED GFU15 with Pacific Crest PDL GFU14 with Satel-
line 3AS, GFU27 with Satelline M3-
TR1 Power LED any device iCON gps 80, Using iCON gps 80 26 3.5 Using USB Memory Devices Insert and remove a USB Memory device step-by-step 2 3 1 005749_001 Step Description
Ensure the instrument is placed in its fixed position or place it onto a stable surface. Loosen the knurled screw of the USB port cover. Flip the cover aside. Slide the USB Memory device firmly into the USB host port until it clicks into position. 1. 2. 3.
Take care not to damage the USB Memory device when moving the iCON gps
Its recommended to close the USB port cover when no USB Memory device 80 or when handling around the device. is used. Preconditions for using USB Memory devices USB Memory devices must be formatted in the FAT or FAT32 format. To import data from a USB Memory device to the iCON gps 80 appropriate folders must be created on the USB device and the files placed in the correct folder. Refer to "6.6 Import, Export, or Delete Data" for further information. 3.6 Quick Release Machine Bracket CMB6 Installation infor-
mation Installation of the Quick Release Machine Bracket CMB6 should be carried out in a way to respect following aspects:
Stable mounting construction, in a position without interfering the operators work space. The Quick Release Base Bracket as part of the CMB6 must be installed on the machine or the desired installation spot accordingly, either using the Magnetic Mount or bolted. Easy and secure access to attach and detach the iCON gps 80 instrument. Easy and secure access to all connected cables. Easy access to the iCON gps 80 keys and a clear view on the display. iCON gps 80, Using iCON gps 80 27
Like all other installation works, the installation of the CMB6 must be done by a dedicated installation specialist. Please contact the local selling unit or dealer for further information. Attach and detach the iCON gps 80 step-by-step Attach the iCON gps 80 3 1 2 005863_002 Step Description
iCON gps 80 needs to be pre-assembled with the left and right clamping rail of the Quick Release Machine Bracket CMB6. The Quick Release Base Bracket must be pre-installed on the machine or the desired installation spot accordingly, either using the Magnetic Mount or bolted. Insert the iCON gps 80 into position on the "fixed jaw" side of the Quick Release Machine Bracket CMB6. Lower the instrument on the "spring jaw" side of the CMB6, until the locking bolt snaps into place. If applicable, attach a padlock to the feed through and lock up. Connect all cables needed for the current configuration to the corre-
sponding connectors. Cables and connectors are colour coded, for easy assignment. 1. 2. 3. 4.
Ensure to connect all cables to the corresponding connector, to protect the instruments from damage. When the cables have been stored on a dummy plug before, close the dummy plug with its protection cap. 5. iCON gps 80, Using iCON gps 80 28 Detach the iCON gps 80 4 3 006355_001 Step Description
Before detaching the iCON gps 80, ensure the instrument is properly shut down and power switched off. To detach the iCON gps 80, first detach the connected cables one by one and store them onto a proper dummy plug. Connector positions and dummy plugs are symbol coded, for easy assignment. If applicable, unlock and detach the padlock. Withdraw the locking bolt from its locking position and arrest it in open posi-
tion by rotating. Slide the instrument on the guiding rails of the Quick Release Machine Bracket CMB6 out of the guides and remove the instrument. Take care not to cant the upper and lower part of the CMB6. Refit the protection caps of the iCON gps 80 plugs. 1. 2. 3. 4. 5.
The plugs of the iCON gps 80 and the CMB6 should always be covered using the corresponding protection cap, when no cable is plugged in. Installation on a Machine In general, all installation works must be done by a dedicated installation specialist. Please contact the local selling unit or dealer for further information. The installation information within this User Manual is indicated to increase the oper-
ators understanding of the system and its maintaining. Before installation:
Please observe the maximum vibration and ambient temperature values indicated in chapter "9 Technical Data". Check that all parts needed are delivered. Refer to "2.2 Unpacking the Container"
for further information. It is strongly recommended that you bench test all components before commencing installation on the actual machine to make sure that all components are fully oper-
ational. 3.7
iCON gps 80, Using iCON gps 80 29 Installation location The iCON gps 80 instrument should preferably be installed either inside a compart-
ment just behind the cabin or in the machine cabin itself. If the machine has no space inside a weather proof compartment or cabin, the instrument is to be installed only on components that have no direct connection to the machine tool and/or are posi-
tioned separately from the tool or at locations that lie in the safe area of the mechan-
ically moving components. Further, the instrument is to be installed so that it is protected from mechanical influences, for example stoning. Examples of a correctly placed instrument. 006174_001 005939_001
The product must not be installed on the tool of the machine and/or on mechanical components that move the tool. Tools include for example bucket of excavator, blade of dozer, screed of paver. Mechanical parts include for example boom and stick of an excavator, hydraulic cylinder of a dozer or tow arm of an asphalt paver. Further, the instrument must not be installed near chassis, chain gear, wheels or on engine components connected to the engine itself. The cases stated are intended simply as examples. iCON gps 80, Using iCON gps 80 30 Installation direc-
tion Fastening For inside assembly, the iCON gps 80 instrument must be installed either vertically with the connectors pointing upwards/downwards or horizontally on a flat plane. Easy access to the keys and a clear view on the display should be guaranteed. For outside assembly, it is strongly recommended to install the instrument vertically with the connectors pointing downwards, in case this is not possible horizontally on a flat plane, but never with the connectors pointing upwards. The iCON gps 80 instrument must have supports beneath all mounting holes and should be fastened with four M6 bolts (or equivalent). The Quick Release Machine Bracket CMB6 is easy to handle and forms a secure mounting option for the instrument. The Quick Release Base Bracket as part of the CMB6 must be installed on the machine, either using the Magnetic Mount or bolted. Quick Release Machine Bracket The special Quick Release Machine Bracket CMB6 can be used for a fast withdrawal of the iCON gps 80 instrument.
The CMB6 should be be installed in a location that allows easy releasing and simple removing of the iCON gps 80 instrument. Refer to "3.6 Quick Release Machine Bracket CMB6" for further information. Electrical grounding The electrical grounds of a Machine may be at different potentials either due to other large current electronic devices on the machine or when different grounds of the machine are isolated in service or welding operations. Different DC and RF noise may exist at different points in the machine which is out of the control of Leica Geosystems. Such noise may have a negative effect on the satel-
lite tracking performance of the iCON gps 80. For this reason, it is best that all external antennas connected to the iCON gps 80, including the GNSS antenna(s), radio antenna and modem antenna, are isolated from the machine. This avoids additional ground paths being introduced.
In an ideal installation, with isolated antennas, the connection of the
It is extremely important to disconnect all cables from the iCON gps 80 grounding pin on the rear panel of the iCON gps 80 to the machine should not be required. before starting any welding operations on the machine. Otherwise the instrument may be damaged beyond repair. iCON gps 80, Using iCON gps 80 31 Installation of GNSS antennas For best results, it is recommended to mount the two GNSS antennas according to following guidelines:
separated as far as possible, at approximately the same height, with the TNC connectors orientated in approximately the same direction, and ensuring an unobstructed view of the sky. Installation on an excavator:
One mast should be placed on each side of the machine. Be aware of heat from Install the two GNSS antennas on the masts in the back of the machine. the exhaust. 005940_001 Installation on a grader/dozer:
Install the GNSS antenna on the mast on the blade. Be aware of heat from the exhaust. 005941_001 Installation of external radio In case the external GFU radio cannot be mounted directly on the iCON gps 80 due to space limitations, then a special bracket for proper mounting can be used. GFU bracket: MMB1250, GFU Bracket on Machine iCON gps 80, Using iCON gps 80 32 Installation of antennas for internal/external radios and modems Cable installation External antennas with a magnetic mount can be used and installed on the roof of the cabin. This will increase the radio signal and therefore the reception of correction signals from a base station or when using a NTRIP solution. 005942_001 Ensure that the cables between iCON gps 80 and CGA60 antenna in particular are installed so as to prevent them from becoming bent and stretched. It is strongly recommended to use strain relief brackets. Route the cable as directly as possible and avoid crossing cables. Be sure not to tie the cables into hot hydraulic hoses.
Connecting the wrong antenna to the wrong connector may cause damage to the antennas. In order to minimise the chance of connecting the incorrect external antenna, the four TNC connectors are colour coded. Cables with corre-
sponding colours are available. The colour coding is as follows:
a b 006150_001 c d a) White: Radio b) Black: Modem c) Blue: GNSS Antenna 1 d) Red: GNSS Antenna 2 iCON gps 80, Using iCON gps 80 33 3.8 3.8.1 Antenna Heights Understanding Antenna Heights Description The height of the GNSS antenna above a point consists of three components:
the vertical or slope height reading, the vertical offset, the vertical phase centre offset. For most operations, pre-configured standard settings in the instrument can be used. They automatically take the vertical phase centre offsets into account. MRP The antenna accepts vertical height readings to the Mechanical Reference Plane, MRP. Vertical phase centre variations These are handled automatically in the standard antenna records. The antenna cali-
brations to determine the phase centre variations were executed by Geo++ GmbH.
3.8.2 Description Pillar setup. For other than the GRT146 carrier, the dimensions must be determined and the vertical offset must be adapted. Tripod setup. For height measurement devices other than the height hook, the dimensions must be determined and the vertical offset must be adapted. Mast setup. The dimensions of the mast must be determined. The Mechanical Reference Plane, MRP The Mechanical Reference Plane:
varies for different instruments. is where the instrument heights are measured to. is where the phase centre variations refer to. MRP of the antenna The MRP for the CGA60 antenna is shown in the diagram. 005752_001 a a) The mechanical reference plane is the underside of the threaded metal insert. iCON gps 80, Using iCON gps 80 34 3.8.3 Measuring the Antenna Height for a Pillar Setup Measuring the antenna height -
pillar setup Setup type Antenna name Pillar CGA60 The required measurement the vertical height reading to the MRP. a b c d a) Mechanical reference plane MRP b) Vertical phase centre offset for L1 c) Vertical phase centre offset for L2 d) Vertical Height Reading 005753_001 No vertical offset. Determining the antenna height with the GRT146 carrier step-by-step Step 1. Description Measure a height from the pillar benchmark to a surface on the carrier. m m 5 5 4 1
. m m 9 0 1 m m 5 6 3
. 005755_001 2. 3. Use the appropriate measurement from the diagram above. Determine the height difference between the measured surface on the carrier and where the MRP of the antenna sits on the carrier. The vertical height reading = adding the values in step 1. and step 2. iCON gps 80, Using iCON gps 80 35 3.8.4 Measuring the Antenna Height for a Tripod Setup Measuring the antenna height -
tripod setup Setup Type Antenna type Tripod CGA60 The required measurement the vertical height reading from the height hook. a b c d e a) Mechanical reference plane MRP b) Vertical phase centre offset for L1 c) Vertical phase centre offset for L2 d) Vertical offset e) Vertical Height Reading Vertical offset = 0.36 Description The vertical height reading = vertical height reading from the height hook. The vertical height reading is the height difference between the ground mark and the bottom end of the height hook. The vertical offset of 0.36 m is automatically stored in the antenna setup record for a tripod setup and will automatically be taken into account. It does not need to be entered. Determining the antenna height with the height hook step-by-step 005754_001 Step 1. 3.8.5 Measuring the Antenna Height for a Mast Setup Measuring the antenna height -
pole setup Setup Type Antenna type Mast CGA60 The required measurement vertical distance from the GNSS antenna MRP to a fixed point on the top of the blade (when the blade has both zero long fall and cross fall). iCON gps 80, Using iCON gps 80 36 3.9 Dual GNSS Positioning and Heading General information When two GNSS antennas are connected to the iCG82 instrument and have a clear view of the sky, the instrument automatically provides a precise GNSS heading relative to True North.
ORP outputs heading relative to grid north instead of true north when a local grid coordinate system is used. The HDT, VTG, XDR messages will always be relative to true north as defined in NMEA-0183 standard. The iCG82 uses a Advanced SmartHeading method of calculating the precise position of the secondary GNSS antenna. This means that precise heading output is available even when the instrument is not receiving corrections from a base station. The antenna connected to port ANT1 is always the primary GNSS antenna while the one on port ANT2 is always the secondary (heading) GNSS antenna. For best results, it is recommended to mount the two GNSS antennas according to following guidelines:
separated as far as possible, at approximately the same height, with the TNC connectors orientated in approximately the same direction, and ensuring an unobstructed view of the sky. Mounting of GNSS antennas Heading Adjust-
ment Heading output is the azimuth from GNSS Antenna 1 to GNSS Antenna 2. If it is not possible to mount the antennas parallel to the centreline of the vehicle, then the known orientation to the centreline can be entered as a Heading Adjustment. The Heading Adjustment field offers the opportunity to enter an angle correction in order for the heading to be calculated in the exact direction of the machine. It is important to note that:
The Heading is the vector from Antenna 1 to Antenna 2 in degrees clockwise from north rather than clockwise from the vehicle reference frame. The Heading Adjustment is always applied from a birds eye view perspective. A positive Heading Adjustment is applied clockwise from North while a negative Heading Adjustment is applied anti-clockwise from North. The following picture illustrates that interrelationship. N f a b c 005946_001 ee d a) North b) GNSS Antenna 1 c) GNSS Antenna 2 d) Heading (135) e) Heading Adjustment (-90) f) Heading output (45) iCON gps 80, Using iCON gps 80 37 Heading output Heading information is available in the Position sub menu on the display. Heading output can be configured on either of the serial ports (P1 or P2) using the NMEA Output wizard. Heading output is available in following message formats:
Leica ORP NMEA HDT NMEA VTG NMEA XDR Refer to "6.3 ORP and NMEA Output" for further information. iCON gps 80, Using iCON gps 80 38 4
4.1 Single GNSS setup with internal radio modem Setups with Accessories In the following chapters example configurations are shown, covering the most common use cases. Further configurations are possible. Please contact the local selling unit or dealer for information regarding special use cases. Single GNSS Setup, with Internal Radio a b c d 005864_001 e b f g h i j k l m a) Radio antenna CA12 b) CA22 Magnetic radio antenna mount, c) CGA60 Robust triple frequency GNSS 2 x antenna d) CA16 Antenna cable, 10 m e) Modem antenna CA26 f) Junction box / Machine Power Supply g) CAN cable h) iCG81 Instrument i) Satel radio CCD14 j) Quick Release Machine Bracket CMB6 k) Machine PC l) Cable for cradle 5Pin M12/open end, 5 m m) CTC4 Carry Case
All necessary installation works must be done by a dedicated installation specialist. Please contact the local selling unit or dealer for further information. iCON gps 80, Setups with Accessories 39 4.2 Single GNSS Setup, with External Radio Single GNSS setup with external radio modem a b c d e 005865_001 f b g h i j k l m a) Radio antenna CA12 b) CA22 Magnetic radio antenna mount, 2 x c) External radio modem GFU27 d) CGA60 Robust triple frequency GNSS antenna e) CA16 Antenna cable, 10 m f) Modem antenna CA26 iCG81 Instrument g) Junction box / Machine Power Supply h) CAN cable i) j) Quick Release Machine Bracket CMB6 k) Machine PC l) Cable for cradle 5Pin M12/open end, 5 m m) CTC4 Carry Case
All necessary installation works must be done by a dedicated installation specialist. Please contact the local selling unit or dealer for further information. iCON gps 80, Setups with Accessories 40 4.3 Dual GNSS Setup, with Internal Radio Dual GNSS setup with internal radio modem a b c c d d 005866_001 e b f g h i j k l m a) Radio antenna CA12 b) CA22 Magnetic radio antenna mount, c) CGA60 Robust triple frequency GNSS 2 x antenna, 2 x d) CA16 Antenna cable, 10 m, 2 x e) Modem antenna CA26 f) Junction box / Machine Power Supply g) CAN cable h) iCG82 Instrument i) Satel radio CCD14 j) Quick Release Machine Bracket CMB6 k) Machine PC l) Cable for cradle 5Pin M12/open end, 5 m m) CTC4 Carry Case
All necessary installation works must be done by a dedicated installation specialist. Please contact the local selling unit or dealer for further information. iCON gps 80, Setups with Accessories 41 4.4 Local Base Station Setup, on Tripod Local Base Station setup, on Tripod a b c d e f g h 005947_001 i j k k l m a) CGA60 Robust triple frequency GNSS antenna b) GSZ4-1 Height hook c) Carrier GRT246 d) CTB102 Tribrach, with optical plummet e) iCG81 Instrument f) External battery GEB371 g) MSC1259 Cable instrument to external battery, 1.8 m h) Wooden tripod GST05 i) Gainflex radio antenna j) GAD33 Arm 15 cm long, attaches to GNSS antenna k) Antenna cable, 2.8 m, 2 x l) Satel radio CCD14 m) CCTC3 Carry Case Local Base Station setup, on Tripod step-by-step Step Description
Ensure Satel Radio CCD14 is correctly installed and configured. 1. Setting Up the Equipment Set up the tripod, mount and level the CTB102 tribrach onto the tripod. Check that the tribrach is correctly centred over the marker. Place and lock the GRT246 carrier into the tribrach. Screw the CGA60 GNSS antenna onto the carrier. Attach the GAD33 arm to the base of the CGA60 GNSS antenna. Attach the Gainflex radio antenna to the GAD33 arm.
The GAD32 telescopic rod can be used to increase the antenna height. This will increase the radio signal and therefore the reception of correction signals from a base station or when using a NTRIP solution. Check that the tribrach is still correctly positioned and levelled. Hang the iCG81 instrument onto a tripod leg. Hang the external battery GEB371 onto a tripod leg. Use the Antenna cable to connect the GNSS antenna to port ANT1 on the iCG81. Use the second Antenna cable to connect the GAD33 arm to the RADIO port on the iCG81. Use the MSC1259 cable to connect the external battery to the P1 port on the iCG81. Turn on the instrument.
GSZ4-1 Height hook is needed to measure the Antenna Height later on. Perform a Base Station setup on the iCG81. Refer to "6.1 Base Setup" for further information. 2. iCON gps 80, Setups with Accessories 42 4.5 Local Base Station Setup, on Pillar Local Base Station setup, on Pillar a b c d d e 005948_001 f g h i j k a) CGA60 Robust triple frequency GNSS antenna b) Carrier GRT246 c) CTB102 Tribrach, with optical plummet d) Antenna cable, 2.8 m, 2 x e) MSC1259 Cable instrument to external battery, 1.8 m f) Gainflex radio antenna g) GAD33 Arm 15 cm long, attaches to GNSS antenna h) iCG81 Instrument i) Satel radio CCD14 j) External battery GEB371 k) CCTC3 Carry Case Local Base Station setup, on Pillar step-by-step Step Description
Ensure Satel Radio CCD14 is correctly installed and configured.
The pillar must be prepared to mount the CTB102 tribrach to. 1. Setting Up the Equipment Mount and level the CTB102 tribrach onto the pillar. Place and lock the GRT246 carrier into the tribrach. Screw the CGA60 GNSS antenna onto the carrier. Place the iCG81 onto the pillar or any other suitable location. Place the external battery GEB371 onto the pillar or any other suitable location. Attach the GAD33 arm to the base of the CGA60 GNSS antenna. Attach the Gainflex radio antenna to the GAD33 arm. Use the Antenna cable to connect the GNSS antenna to port ANT1 on the iCG81. Use the second Antenna cable to connect the GAD33 arm to the RADIO port on the iCG81. Use the MSC1259 cable to connect the external battery to the P1 port on the iCG81. 2. Turn on the instrument. Perform a Base Station setup on the iCG81. Refer to "6.1 Base Setup" for further information. iCON gps 80, Setups with Accessories 43 4.6 Local Base Station Setup, with External Radio Local Base Station setup, with external radio a b c d e f g h i 005949_001 j k l l m a) CGA60 Robust triple frequency GNSS h) MSC1259 Cable instrument to external antenna b) GSZ4-1 Height hook c) Carrier GRT246 d) CTB102 Tribrach, with optical plummet e) iCG81 Instrument f) Radio modem GFU device g) External battery GEB371 battery, 1.8 m i) Wooden tripod GST05 j) Gainflex radio antenna k) GAD33 Arm 15 cm long, attaches to GNSS antenna l) Antenna cable, 2.8 m, 2 x m) CCTC3 Carry Case Local Base Station setup, with external radio step-by-step Step Description
Ensure the external Radio modem GFU device is correctly installed and 1. configured. Setting Up the Equipment Set up the tripod, mount and level the CTB102 tribrach onto the tripod. Check that the tribrach is correctly centred over the marker. Place and lock the GRT246 carrier into the tribrach. Screw the CGA60 GNSS antenna onto the carrier. Attach the GAD33 arm to the base of the CGA60 GNSS antenna. Attach the Gainflex radio antenna to the GAD33 arm. Check that the tribrach is still correctly positioned and levelled. Hang the iCG81 instrument onto a tripod leg. Hang the external battery GEB371 onto a tripod leg. Attach the external Radio modem GFU device to the P2 port on the iCG81 instrument. Use the Antenna cable to connect the GNSS antenna to port ANT1 on the iCG81. Use the second Antenna cable to connect the GAD33 arm to the GFU device. Use the MSC1259 cable to connect the external battery to the P1 port on the iCG81. Turn on the instrument.
GSZ4-1 Height hook is needed to measure the Antenna Height later on. Perform a Base Station setup on the iCG81. Refer to "6.1 Base Setup" for further information. 2. iCON gps 80, Setups with Accessories 44 4.7 Local Base Station Setup, Permanent Local Base Station setup - Permanent a b c d e f g h i 005955_001 a) CGA60 Robust triple frequency GNSS antenna b) Carrier GRT246 c) CTB102 Tribrach, with optical plummet d) Modem antenna CA26 e) CA22 Magnetic radio antenna mount, 2 x f) CA16 Antenna cable, 10 m j e k l m n g) Antenna cable, 2 x h) Power supply unit GEV208 i) AC power cable, country specific j) Radio antenna CA12 k) iCG81 Instrument l) Satel radio CCD14 m) GEV219 Cable Lemo 8 pin to Lemo 5 pin n) CCTC3 Carry Case Local Base Station setup, Permanent step-by-step Step Description 1.
Ensure Satel Radio CCD14 is correctly installed and configured.
The site/office/container must be prepared to mount the CTB102 tribrach to, in a way, to ensure a clear view of the sky for the GNSS antenna. Setting Up the Equipment Mount and level the CTB102 tribrach onto the site/office/container. Place and lock the GRT246 carrier into the tribrach. Screw the CGA60 GNSS antenna onto the carrier. Attach the CA22 magnetic radio antenna mount together with the CA12 radio antenna to the site/office/container. Attach the second CA22 magnetic radio antenna mount together with the CA26 modem antenna to the site/office/container.
The higher the radio antennas are mounted, the better the radio transmis-
sion range. Place the iCG81 instrument onto a prepared suitable location. Use the Antenna cable to connect the CA12 radio antenna to the RADIO port of the iCG81 instrument. Use the second Antenna cable to connect the CA26 modem antenna to port P2 of the iCG81 instrument. Use the CA16 Antenna cable to connect the GNSS antenna to port ANT1 of the iCG81 instrument. Use the GEV219 power cable to connect the Power supply unit to port P1 of the iCG81 instrument. iCON gps 80, Setups with Accessories 45 Step 2. Description Connect the AC power cable to the Power supply unit GEV208 and plug it into the power outlet. Turn on the instrument. Perform a Base Station setup on the iCG81. Refer to "6.1 Base Setup" for further information. iCON gps 80, Setups with Accessories 46 5 5.1 iCON gps 80 User Interface User Interface Description User Interface over-
view a b c d e f g e f User Interface elements 005683_001 a) ON/OFF key b) Power and status LED c) Ambient light sensor d) Display e) ESC key f) ENTER key g) Navigation keys The instrument can be controlled via the user interface elements. Element Navigation keys Enter key ESC key ON/OFF key Display Ambient light sensor Power LED Function 4-way navigation in the menus via left, right, up and down key. To activate editing. To accept changes. To enter a menu or submenu. To cancel operations. To leave a menu or submenu. Gives access to startup and shutdown: press for three seconds. Displays status information and software func-
tions. Energy saving ambient light sensor.
When the display Backlight is set to Auto, the Backlight intensity is automat-
ically adjusted on the ambient light sensor input. off continuously green continuously red During start-up of the instrument. Instrument is switched off. Normal operation mode. Position acquired. For various errors occuring. The current status information is shown on the display. submenus.
Use the and navigation keys to select a menu icon and to navigate within
Use the
Use the key to discard settings, cancel operations and to go back one menu key to enter a submenu and confirm settings. level. iCON gps 80, iCON gps 80 User Interface 47 Display orientation To enable a proper view on the display for various mounting options the iCON gps 80 allows to flip the screen, providing a up-side-down use of the display. 1) Access the wizard via Settings > System Configuration > Screen Settings. 2) Choose the Flip Screen setting to meet your needs:
No: for the default display orientation. Yes: to rotate the display orientation by 180. 3) Press to confirm your setting. The display orientation is changed immediately. 5.2 Main Menu Description The Main Menu is the first screen displayed when the instrument is switched on. Main Menu content The Main Menu features a matrix set of menu icons.
The appearance of the menu icons depend upon the current instrument status and setup. c b a d a) Position icon b) Satellite icon c) Radio icon d) Modem icon e) Power icon f) Bluetooth icon g) iCON telematics/Port Summary icon h) Memory and logging icon i) Settings icon e 005871_001 f g h i Additional icon information The menu icons on the display provide additional information related to basic instru-
ment status. Icon Position Description Instrument has not obtained a position. xRTK position has been obtained. Navigated position has been obtained. Error 10 m. Float position has been obtained. Error 0.5 m. Error < 0.05 to 0.10 m. High accuracy position has been obtained. Error 0.05 m. Navigated position plus high accuracy heading have been obtained. Float position plus high accuracy heading have been obtained. xRTK position plus high accuracy heading have been obtained. High accuracy position plus high accuracy heading have been obtained. No GNSS antenna is connected to the instrument. iCON gps 80, iCON gps 80 User Interface 48 Icon Description iCON gps 80 is operating as a base. BasePilot setup in progress. BasePilot setup failed. Icon Satellite Description No satellites tracked. Number of tracked satellites. Icon Radio Description Radio not in use. Radio set to receive correction data in rover mode. Active radio channel is displayed. Waves flash when correction data is received. Radio set to transmit correction data in base mode. Active radio channel is displayed. Waves flash when correction data is transmitted. Radio frequency set manually. Radio error. Sensor is receiving corrections over SmartLink due to an interrupted or broken radio link. Icon Modem Description Modem not in use. Modem connected to a cell phone network. Modem set to receive correction data in rover mode. Waves flash when correction data is received. Modem set to transmit correction data in base mode. Waves flash when correction data is transmitted. Modem error. Sensor is receiving corrections over SmartLink due to an interrupted or broken modem link. iCON gps 80, iCON gps 80 User Interface 49 Icon Bluetooth Description Bluetooth OFF. Bluetooth ON. Bluetooth connection active. Icon Power Description External power is used. External power is used, low voltage warning. Icon iCON Telem-
atics/Port Summary Description iCON Telematics is not configured or is configured but idle. New iCON gps 80 firmware is available for download from iCON Telematics. View function enabled in iCON Telematics. Flashing arrows in the icon: Track function enabled in iCON Telematics. iCON Telematics error. Port Summary: View the current status for the NMEA output, Remote (MPI), CAN, and PPS. Ethernet Status: View the current Ethernet status. Icon Memory and logging Description Memory icon (internal memory). USB Memory device inserted. Raw data logging ongoing. Memory error (internal memory is full, needs attention). Icon Settings Description Settings icon. iCON gps 80, iCON gps 80 User Interface 50 5.3 5.3.1 Submenus Navigation in Submenus How to navigate in submenus Locked Submenus Use the and navigation keys to select a submenu entry. To enter a submenu, highlight the menu entry of interest and press Use the and navigation keys to navigate through a submenu with multiple
. pages. Example of a submenu
Small boxes at the bottom of a submenu page indicate the number of pages within the submenu, while a solid black box indicates the current page.
Features that are not active due to a missing licence are marked with a lock symbol (
). 5.3.2 How to Change Settings and Edit Values How to change settings Enter the desired submenu as described before, for example Antenna 1 settings. The first editable value is automati-
cally selected, indicated by a frame around the entry. Use the and navigation keys, to select the desired option, for example Measure. Press to enter the list of available options. Use the and navigation keys to scroll through the list of options. Press press to confirm the selection, or to discard the setting and cancel the operation. iCON gps 80, iCON gps 80 User Interface 51 Select and edit values Enter the desired submenu as described before, for example Antenna 1 settings. Use the and navigation keys, to select the desired option, for example Height. Press Use the and navigation keys, to to enter the input field. change the value of a digit. Use the and navigation keys to change to another digit. Press press to confirm the setting, or to discard the setting and cancel the operation. Enter numbers or text The user interface is equipped with a virtual keyboard for alphanumerical and numer-
ical input.
The virtual keyboard works similar to a mobile phone keyboard. Press repeatedly to toggle between the different characters. First select a submenu item, as shown in the example. Press Use the navigation keys to select a key to edit a number/text field. on the virtual keyboard. Press
(if necessary repeatedly) to select and enter a character or number. Highlight and press to save the changes. Special keys A>a>123 Function Switches between upper/lower case characters and the numerical keyboard. Moves the position of the cursor. Deletes the character left of the cursor (backspace func-
tionality). Stores the current content of the description field and ends input mode. iCON gps 80, iCON gps 80 User Interface 52 5.3.3 Available Sub Menus Informs about:
Position Quality:
Position Menu Satellite Menu Position Quality Height Quality GDOP: Geometric Dilution Of Precision. The smaller the number, the higher the possible precision. Solution: Navigated, Float, Fixed (XRTK) or Fixed The coordinate system used: WGS84, Via Network or any loaded coordinate Heading: is the vector from GNSS Antenna 1 to GNSS Antenna 2, applied from a birds eye view perspective, in degrees clockwise from north. Refer to "3.9 Dual GNSS Positioning and Heading" for further information. The active GNSS antenna Height of the active antenna Measurement mode of antenna height: Vertical, Sloped to Mark, or Height Position Antenna:
system files. Position Coordinates Position Height Heading:
Slope Distance Tilt Solution Antenna 1 (and 2):
Hook RTK Mode:
The active RTK Mode BasePilot: Used or Not Used Current Date & Time Configurable values (if external antenna is connected):
Antenna (1 and 2) type Antenna (1) height Measurement mode of Antenna (1) height
Information about Antenna 2 as well as Heading is only valid for the iCG82 instrument with installed Dual positioning and Heading licence, when both GNSS antennas are connected and have a clear view of the sky. Informs about:
Satellites Antenna1 (and 2):
The number of tracked satellites and available satellites, if no position is given The number of used satellites and available satellites, when position is available
(no base correction data received).
(with base correction data). Cut-Off Angle: below this defined angle satellites will not be taken into account for calculations. Reference Satellites:
The number of reference satellites, in rover mode only. Configurable value:
Cut-Off Angle, for iCG82 applied to both antennas. iCON gps 80, iCON gps 80 User Interface 53 Radio Menu Informs about:
Radio status information, including managing internal power supply for the radio Connection details of the internal and / or external radio Base station information Configurable values:
Radio channel, frequency and bandwidth Protocol (for some radio types only) Correction format (only in base mode) Internal power supply Yes/No, Radio On/Off When in base mode, the RTK correction format can be edited from within the radio menu. FEC (Forward Error Correction) (for some radio types only)
For an internal Satelline radio or an external GFU27 radio the frequency can be set manually and FEC turned On/Off, when radio firmware version 06.17.3.61 or higher is installed. Modem Menu Informs about:
Internal Modem:
Modem type and connection details Managing internal power supply for the modem RTK status Base Station information Internal power supply for the modem Yes/No Configurable values:
Modem connect/disconnect Selected mobile internet service type Correction format (only in base mode) When in base mode, the RTK correction format can be edited from within the modem menu. Power Menu Informs about:
The port used for external power supply The input voltage Configurable values:
None Bluetooth Menu Informs about:
Bluetooth connection details and status Configurable value:
Activate/deactivate Bluetooth iCON gps 80, iCON gps 80 User Interface 54 iCON Telematics and Port Summary Menu Storage Menu Settings Menu Settings Menu:
Tools Informs about:
The status of iCON Telematics and its functions View, Track and Sync Enable or disable the Share screen function, to allow a remote user to view the instruments screen The different ports and their usage/status Configurable values:
Activate/deactivate Share screen Informs about:
Internal Memory:
Free/Used/Total Memory Raw data logging active/inactive USB Storage:
Free/Used/Total Memory, when a USB memory device is inserted Configurable values:
None Contains following submenus:
Tools System Information System Configuration Service Copyrights Functions Base Setup Rover Setup NMEA Output Raw Data Logging iCON Telematics Description Execute a Base Station setup. Refer to "6.1 Base Setup" for further information. Execute a Rover setup. Refer to "6.2 Rover Setup" for further information. Attend the NMEA Output settings. Refer to "6.3 ORP and NMEA Output" for further information.
The appropriate license must be installed to access the NMEA Output wizard. Setup/Start Raw Data Logging. Refer to "6.4 Raw Data Logging" for further information. View the Log file list. Export Log files to a connected USB memory device. Delete all Log files. View the current iCON Telematics Status. iCON Sync Download: download data from the iCON telematics web page. iCON Sync Upload: upload data to the iCON telematics web page. iCON Telematics Firmware: search for and execute avail-
able instrument firmware updates from the iCON telem-
atics web page. Perform a iCON Telematics Setup.
Refer to "6.5 iCON Telematics" for further informa-
tion on the different functions. iCON gps 80, iCON gps 80 User Interface 55 Functions Import / Export / Delete Description Import data from a connected USB memory device. Export data to a connected USB memory device. Delete data stored on the instrument. Available options to delete: Base point list, Welcome screen, Support logs, and Coordinate systems. Licenses Settings Menu:
System Information Functions System Information Settings Menu:
System Configura-
tion Functions Upload Firmware GNSS Settings Coordinate systems PPS Output View active licenses. Upload license file from a connected USB memory device. Enter license key. Delete all licenses stored on the instrument. Instrument Type and Serial Number. Description Active firmware version. Information about the Measurement Engine(s), the Internal Radio, and the Internal Cell Modem. Description Single Firmware file selectable to upgrade the instruments firmware. Firmware file must be placed in a folder called system on a USB memory device. Configure GNSS tracking settings GPS L2C, GPS, GLONASS, Galileo & BeiDou. To activate or deactivate xRTK.
xRTK is a slightly less accurate RTK position type, typically 5 to 10 cm, automatically providing more availability for phase fixed positions with a reliability of 99%. Recommended when working in heavy canopy environments. For NMEA messages, posi-
tions measured with the xRTK mode are flagged as fixed. Set the Heading Adjustment. To activate or deactivate SmartLink. SmartLink is available for all RTK formats and indepen-
dently from the xRTK configuration. SmartLink is a correction service delivered via Satellite to bridge RTK corrections outages for long periods of time, for example 10 minutes. Use SmartLink to work for longer without the consistent usage of the RTK infrastructure. not changed. lite signals are unavailable in SmartLink mode.
GPS L5, Galileo E5a/E5b/AltBOC and BeiDou B2 satel-
The configurations in Satellite Tracking Settings are
The SmartLink functionality is licenced. To set the Coordinate system used. Choose from WGS84, Via Network or any loaded coordinate system files. Set the PPS Output parameters: Rate and Polarity. Further information can be found below. iCON gps 80, iCON gps 80 User Interface 56 Functions Reset Options Choose Language Screen Settings Startup & Shutdown Date & Time Units & Formats Upload ME Firmware Network Settings Remote Config Description Reset options are available for the Memory, the External Port Configurations, the Instrument, Almanac, and the Antenna list.
The Almanac is a set of data that every GNSS satellite transmits, and it includes information about the state of the entire satellite constellation, and coarse data on every satellite's orbit. When the iCON gps 80 instrument has current almanac data in memory, it can acquire satellite signals and determine initial position more quickly. Change system language. Set display Backlight options:
Auto: Ambient light sensor is used to automatically adjust screen backlight for best display. Full: Screen backlight is set to full brightness. Off: Backlight is turned off. Set display Power Saver options:
Off: Screen backlight will not turn off. 5 s, 30 s, 1 min., ...: Screen backlight remains on for the time period set following the last key press. Flip the Screen: to activate/deactivate up-side-down use of the display. When Start on Pulse to Port is set to On: The instrument will automatically start up after receiving a pulse signal on port P1. When Start on Power to Port is set to On: The instrument will automatically start up when power is available on port P1, CAN1 or CAN2. Define Time Zone and Daylight Saving Time. Set the Unit used for Distance. Define Date and Time format. Single ME (Measurement Engine) files selectable to upgrade the ME(s). ME file must be placed in a folder called system on a USB memory device. Select the Internet device: Modem or Ethernet. Define Modem Settings. Define Ethernet Settings. Configure the instrument for remote control using the Leica Machine Control Net Protocol. It is possible to access this protocol via net ports (using Ethernet or Modem), Serial P1 or Bluetooth. When the net ports are used, both TCP and UDP protocols are available in either Server or Client modes. Define the settings for TCP. If settings were done previ-
ously, switch on/off or select as needed. Define the settings for UDP. If settings were done previ-
ously, switch on/off or select as needed. Define the settings for Serial. If settings were done previously, switch on/off or select as needed. CAN Settings Set the CAN Bus rate. Options are 125 kbits/s or 250 kbits/s. Default is 250 kbits/s. iCON gps 80, iCON gps 80 User Interface 57 Functions User Defined Antennas Create or edit up to 50 user defined antennas. Description Give the antenna a user defined Name. Enter values for Hz offset, Vrt offset, and the phase centre offset values L1 ph.off. and L2 ph.off.. Enter the IGS name and a Serial nr.. IGS stands for Inter-
national GNSS Service. It is possible to register antennas and receivers at IGS, and these items are then kept in an official list. All input fields, but the Serial nr., must be completed. There-
fore a list showing these values for the user defined antenna should be present.
Copy add. corr. allows to copy an existing additive constant. User defined antennas are available in the antenna fields for selection, for example in wizards or sub-menus. When a user defined antenna was used for a Base Station setup it is also shown in the Base Point List. Use Usage Report to enable/disable this feature. Use About iCON Analytics to view detailed information about the matters and capacity of this feature. Further information can be found below. iCON Analytics PPS Output - Description PPS stands for Pulse Per Second. If configured, iCON gps 80 sends out an electric pulse at a specified interval time. For example, this could be used to activate another device. PPS output is possible using the Data/Power port P1 on the iCON gps 80. The PPS output source is a 0 V to +5.0 V signal referenced to Vin negative. PPS Output - Parameters to set Rate: Defines the interval at which the pulses are output. Polarity: Defines if the pulses are output at the negative or positive edge of the pulse. iCON Analytics - detailed information Leica Geosystems would like your help to improve this product. Your iCON device can automatically collect diagnostic and usage info from your device and send it to Leica Geosystems for analysis - but only with your permission. Diagnostic and usage infor-
mation may include details about hardware and operating system specifications, performance statistics, and data about how you use your devices and applications. The collected information may also contain the location and serial number of the hard-
ware. This collected information is stored on a cloud based server and will be used for troubleshooting and for shaping future development of the product. We encourage users to select the option to Auto Send diagnostic and usage info when prompted. You may also, at any time, choose to turn off the monitoring of usage altogether. To do so, open System Configuration, iCON Analytics, and choose Don't send. Settings Menu:
Service Functions Service Description Password protected - for Service & Support staff only. iCON gps 80, iCON gps 80 User Interface 58 Settings Menu:
Copyrights Functions Copyrights Description Includes Open Source Software License information. This software contains copyright-protected software that is licensed under various open source licenses. Press Settings > Copyrights to view the copyright information and a link to down-
load the source code and license text. And/Or The according copyright statements and license texts are part of the documenta-
tion delivered with this product. If foreseen in the corresponding open source licence, you may obtain the source code, license texts and other related data on the open source centre website of Leica Geosystems, http://opensource.leica-geosystems.com. 5.4
Connected to iCON 3D, but not in RUN mode iCON gps 80 Screen in Machine Control Mode When the iCON gps 80 is installed into the Leica Machine Control CAN bus as part of a complete 3D Leica Machine Control solution, certain operations on the iCON gps 80 are limited in order to optimise performance and avoid mismatched settings between the GNSS instrument and the 3D panel. When the iCON gps 80 is connected to a 3D panel via a CAN cable, and the 3D panel is not in RUN mode, and traffic on the CAN bus is detected, the iCON gps 80 enters Machine Control mode and following information is shown:
MC mode is active! Not all settings are available in this mode.
Press OK to confirm the information and return to the last active menu. Following restrictions are applied:
All menus of the iCON gps 80 are selectable, except the Tools menu. No changes to the current configuration are possible. Upload Firmware, Reset almanac, and "User Interface only" settings, like Choose Language, and Flip Screen are available in full functionality. Following Machine Control default settings are applied:
Satellite cut-off angle: Automatic Position output: 20 Hz Antenna height: 0 m Heading offset: 0 Start on Pulse to Port: ON Connected to iCON 3D, and in RUN mode When the iCON gps 80 is connected to a 3D panel via a CAN cable, and the 3D panel is in RUN mode, and traffic on the CAN bus is detected, the iCON gps 80 enters Machine Control Run mode and following information is shown:
MC run mode is active! Only status information is available in this mode. iCON gps 80, iCON gps 80 User Interface 59
Press OK to confirm the information and return to the last active menu. Following restrictions are applied:
The iCON gps 80 display can be used for status information only. No changes to the current configuration are possible. Following Machine Control default settings are applied:
Satellite cut-off angle: Automatic Position output: 20 Hz Antenna height: 0 m Heading offset: 0 Start on Pulse to Port: ON
When the iCON gps 80 is in Machine Control Run mode, all non-essential functions for machine control including NMEA output and RINEX logging are disabled in order to optimise instrument performance. iCON gps 80, iCON gps 80 User Interface 60 6 6.1 6.1.1 Software Tools Base Setup Base Setup Description Setup iCON gps 80 as Base Station iCON gps 80 can be setup and used as Base Station. Measured Base Points can be recorded in the instrument and a Base Point list can be imported and used for future Base Setups. There are different options to setup the iCON gps 80 as Base Station:
Manual Base Setup:
When no Base Setup has been performed and recorded before to the iCON gps 80 and no Base Point List has been imported, it is necessary to perform a manual Base Setup. Manual Base Setup is always possible, also with a imported Base Point List or a previously recorded Base Setup. Base Setup using BasePilot:
iCON gps 80 features a tool for automatic Base Setup called BasePilot. BasePilot is enabled automatically when the iCON gps 80 is powered up on an existing base point. BasePilot recognises that the instrument is in base mode, is over a known point and automatically loads the previously stored base configu-
ration. Using the Base Point List The Base Point List comprises a list of known base points with all corresponding base system configuration data. It is used with the BasePilot functionality for fast automatic base configuration.
The Base Point List can be exported, imported and deleted via the Import /
Export / Delete submenu. Refer to "6.6 Import, Export, or Delete Data" for further information. No stored positions nearby If no base point in the Base Point List is close to the current instrument position an information message shows up:
There are no existing Base Points nearby!
6.1.2 Base Setup If this information appears:
Confirm the message by pressing Use the Edit or Smart Get here function to set up the base station. on Continue. Manual Base Setup The instrument can be manually set up as a stand-alone base station without a controller. This can be done in three different ways using the Base Setup wizard:
Smart Get here:
Instrument determines position and uses current position as a new base point. Edit:
Find nearest:
Manual input of coordinates to generate a new base point. Searches through the Base Point List for a known base point within a radius of 20 m of the current instrument position.
The following step-by-step descriptions explain the different options in detail. iCON gps 80, Software Tools 61 Smart Get here step-
by-step The Smart Get here function determines the current coordinates of the instrument and uses this position as the base point. Step 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. Description According to your needs, setup the hardware needed at the desired base point position. Refer to "4 Setups with Accessories" for further information about hardware setup. Access the wizard via Settings > Tools > Base Setup. In the Position screen highlight Modify and press
. Select Smart Get here and press In the Antenna screen select the active Antenna, the Height of the active antenna, and the Measure mode of antenna height. Select Continue and press Refer to "3.8 Antenna Heights" for information about Antenna Heights. In the Measure Setup screen select, set the Meas. Time according to your needs and press to confirm. Continue with to confirm. to confirm. to confirm. If needed, select Corr. Source and press 12. When ready to determine the current position, select Measure and press to confirm. If necessary, select Remeasure and press The instrument measures the current position. Subsequently it searches the Base Point List for stored base points in the vicinity. When measurement is okay, select OK and press If there is already a point within a 40 m radius of the measured point stored in the instrument a message is displayed:
Select Overwrite to use the newly measured position, or select Use existing to use the known point. to confirm. to confirm. In case the existing point has been chosen, a second warning message is displayed where you can choose between Saved setup to use the saved Base point setup, including Antenna and Communication settings, or Current to use the currently loaded configuration. to confirm, If no point is found within a 40 m radius of the measured position the instrument returns to the Position screen. Back in the Position screen select Modify and Edit and press in case the Point ID and/or coordinates want to be adapted. Otherwise select Continue and press In the Edit Position screen:
Select Pt. ID and press Enter a Point ID and press When finished, select Continue and press New Point ID, position and height values are stored and instrument returns to the Position screen. If needed, position and height values can be changed. to confirm. to confirm. to confirm. to confirm. iCON gps 80, Software Tools 62 Step 12. 13. Description Use the navigation key to proceed to the Communication setup screen, to configure a rover. Select between Internal radio, External radio and Network. To configure the settings for Internal Radio continue with 13. To configure the settings for External Radio P2 continue with 14. To configure the settings for Network continue with 15. Otherwise continue with 44. For the Internal Radio select On, Off or Edit and press When Edit was selected:
In the Internal Radio (1) the Model is displayed. In the Internal Radio (2) screen select the Channel, Frequency, and Bandwidth. Protocol and FEC can be defined under Advanced Settings. Please note that Protocol and FEC is only available for the internal Satel radio TA13. For the Intuicom 900SLR only Channel can be selected.
For an internal Satelline radio the frequency can be set manually,
If a frequency is required that is not given as part of a channel, the when radio firmware version 06.17.3.61 or higher is installed. frequency can be typed in manually. If required the bandwidth can be changed as well. to confirm. In the RTK Settings screen select the Corr.Format:
Leica: The proprietary Leica real-time GPS data format supporting GPS L1/L2 and GLONASS L1/ L2. Leica 4G: The proprietary Leica real-time GNSS data format supporting GPS L1/ L2/ L5, GLONASS L1/ L2, Galileo E1/E5a/E5b/AltBOC and BeiDou B1/B2. This format is recommended when working exclusively with Leica instruments. CMR: CMR and CMR+ are compacted formats used to broadcast data for third-party instruments. RTCM 3.1, RTCM 3.2 MSM3, RTCM 3.2 MSM5: Use RTCM when rover units from a different manufacturer are to be used. Use to decode the standard RTCM v3 and the RTCM v3 (MSM) messages from the base. Message according to RTCM version 3. A new standard format for transmission of Global Navigation Satellite System correction infor-
mation. Higher efficiency than RTCM v2.x. Supports real-time services with significantly reduced bandwidth. Still in the RTK Settings screen define the time interval and the use for Time Slicing. When finished, confirm in the Save Settings screen. iCON gps 80, Software Tools 63 Step 14. 15. 16. 17. 18. 19. 20. 21. 22. Description For the External Radio P2 select On, Off or Edit and press When Edit was selected:
In the External Radio (1) screen select the Model:
For generic radio setting (Generic RS232), where no device is auto-
to confirm. detected, select Baud rate, Parity, and Flow contr.. For external radios which are automatically detected, the Model is also selected automatically. In the External Radio (2) screen select the Channel. Protocol and FEC can be defined under Advanced Settings. For external radios which are not automatically detected, select the Model in the External Radio (1) screen and in the External Radio (2) screen select the Channel and the Protocol.
Protocol and FEC are available and the frequency can be set manu-
If a frequency is required that is not given as part of a channel, the In the RTK Settings screen select the Corr.Format from Leica, Leica 4G, CMR, RTCM 3.1, RTCM 3.2 MSM3, RTCM 3.2 MSM5. Refer to step 13. for details. ally just for the external GFU27 radio, when radio firmware version 06.17.3.61 or higher is installed. frequency can be typed in manually. If required the bandwidth can be changed as well. Still in the RTK Settings screen define the time interval and the use for Time Slicing. to confirm. In the Internet conn. screen select Modem or Ethernet as device. When finished, confirm in the Save Settings screen. For the Network select On, Off or Edit and press When Edit was selected:
To configure the settings for Modem continue with 16. To configure the settings for Ethernet continue with 39. In the Int. Modem screen select NTRIP Base, NTRIP Source, TCP Server, or Dialup as Mode. To configure the settings for NTRIP Base continue with 17. To configure the settings for NTRIP Source continue with 24. To configure the settings for TCP Server continue with 29. To configure the settings for Dialup continue with 36. In the Int. Modem screen select NTRIP Base as Mode, enter PIN, APN
(Access Point Name) and select Use/Don't use for the APN ID. When Use is selected:
Use the navigation key to proceed to the next step. In the APN ID screen enter User ID and Password. Use the navigation key to proceed to the next step. In the DynDNS Settings (for Dynamic Domain Name System) screen select the Provider and enter Host, Username and Password. the network provider. When using a SIM card with a fixed IP set DynDNS to Off.
The fixed IP functionality for a SIM card must explicitly be ordered at Use the navigation key to proceed to the next step. In the NTRIP Settings screen enter Port number, Username and Password.
The port number entered must be accessible from outside your local Use the navigation key to proceed to the next step. cell network. iCON gps 80, Software Tools 64 Step 23. 24. 25. 26. 27. 28. 29. 30. 31. 32. 33. 34. 35. 36. 37. 38. Description In the Save Settings screen select the Corr.Format (Correction Format). Refer to step 13. for details. Use the navigation key to save the settings and enable the device. In the Int. Modem screen select NTRIP Source as Mode, enter PIN, APN
(Access Point Name) and select Use/Don't use for the APN ID. When Use is selected:
Use the navigation key to proceed to the next step. In the APN ID screen enter User ID and Password. Use the navigation key to proceed to the next step. In the Caster Settings screen select the Mode and enter Address, Port, Mnt.Pt. (mount point) and Password. Address mode WWW allows the entry of a web address. Address mode IP allows the entry of an IP address. Use the navigation key to proceed to the next step. In the Save Settings screen select the Corr.Format (Correction Format). Refer to step 13. for details. Use the navigation key to save the settings and enable the device. In the Int. Modem screen select TCP Server as Mode, enter PIN, APN
(Access Point Name) and select Use/Don't use for the APN ID. When Use is selected:
Use the navigation key to proceed to the next step. In the APN ID screen enter User ID and Password. Use the navigation key to proceed to the next step. In the DynDNS Settings (for Dynamic Domain Name System) screen select the Provider and enter Host, Username and Password. cell network. the network provider. When using a SIM card with a fixed IP set DynDNS to Off.
The fixed IP functionality for a SIM card must explicitly be ordered at Use the navigation key to proceed to the next step. In the TCP Server screen enter Port number and a number for Max. clients.
The port number entered must be accessible from outside your local Use the navigation key to proceed to the next step. In the Save Settings screen select the Corr.Format (Correction Format). Refer to step 13. for details. Use the navigation key to save the settings and enable the device. In the Int. Modem screen select Dialup as Mode, and enter PIN. Use the navigation key to proceed to the next step. In the Save Settings screen select the Corr.Format (Correction Format). Refer to step 13. for details. Use the navigation key to save the settings and enable the device. iCON gps 80, Software Tools 65 Step 39. 40. 41. 42. 43. 44. 45. Description In the Ethernet screen select the Mode from NTRIP Base, NTRIP Source, and TCP Server. Set DHCP to:
On to use the DHCP (Dynamic Host Configuration Protocol) to automat-
ically get IP address and networking parameters requested from a DHCP server. Use the navigation key to proceed to the next step. In the IP Address screen use the Renew DHCP Lease functionality if necessary. Off to manually enter IP address and networking parameters. Use the navigation key to proceed to the next step. In the DNS Servers screen enter the primary and, if needed, the secondary DNS server parameters. number, Username and Password. Use the navigation key to proceed to the next step. When NTRIP Base was selected: In the NTRIP Settings screen enter Port
The port number entered must be accessible from outside your local When NTRIP Source was selected: In the Caster Settings screen select cell network. the Mode and enter Address, Port, Mnt.Pt. (mount point) and Pass-
word. Address mode WWW allows the entry of a web address. Address mode IP allows the entry of an IP address. cell network. number and a number for Max. clients. When TCP Server was selected: In the TCP Server screen enter Port
The port number entered must be accessible from outside your local Use the navigation key to proceed to the next step. In the Save Settings screen select the Corr.Format (Correction Format). Refer to step 13. for details. Use the navigation key to save the settings and enable the device. Use the navigation key to proceed to the Antenna 1 screen. The active Antenna, the Height of the active antenna, the Measure mode of antenna height and the Ref.Stn.ID (Reference Station Identification) might be changed again. Refer to "3.8 Antenna Heights" for information about Antenna Heights. Use the navigation key to proceed to the final step. To save and apply the new Base Station settings select Save and press to confirm. To discard the new Base Station settings select Undo and press
. To actually discard the settings confirm the following Warning by pressing on OK. Find nearest step-
by-step The Find nearest function searches through the Base Point List for base points in the vicinity. Step 1. 2. Description According your needs, setup the hardware needed at the desired base point position. Refer to "4 Setups with Accessories" for further information about hardware setup. Access the wizard via Settings > Tools > Base Setup. iCON gps 80, Software Tools 66 Step 3. 4. 5. 6. 7. 8. Description In the Position screen highlight Modify and press Select Find nearest and press The instrument searches for base points within a 20 m radius, which are stored in the Base Point List. The closest base point is selected automati-
cally. If a Base Point is found within a 20 m radius of the current position:
Select Saved setup to use the saved Base point setup, including Antenna to confirm. and Communication settings, or to confirm the selection. select Current to use the currently used Base point setup. Press If no Base Point is found within a 20 m radius an according information message is displayed. In this case the Smart Get here or Edit function is needed to setup a base station. Back in the Position screen, re-check the selected base point information. Use the navigation key to proceed to the Communication setup screen, for example to establish a connection via radio.
It is possible to use three communication devices running in parallel. To configure the settings for Internal Radio continue with 9. To configure the settings for External Radio P2 continue with 10. To configure the settings for Network continue with 11. Otherwise continue with 40. iCON gps 80, Software Tools 67 Step 9. to confirm. Description For the Internal Radio select On, Off or Edit and press When Edit was selected:
In the Internal Radio (1) the Model is displayed. In the Internal Radio (2) screen select the Channel, Frequency, and Bandwidth. Protocol and FEC can be defined under Advanced Settings. Please note that Protocol and FEC is only available for the internal Satel radio TA13. For the Intuicom 900SLR only Channel can be selected.
For an internal Satelline radio the frequency can be set manually,
If a frequency is required that is not given as part of a channel, the when radio firmware version 06.17.3.61 or higher is installed. frequency can be typed in manually. If required the bandwidth can be changed as well. In the RTK Settings screen select the Corr.Format:
Leica: The proprietary Leica real-time GPS data format supporting GPS L1/L2 and GLONASS L1/ L2. Leica 4G: The proprietary Leica real-time GNSS data format supporting GPS L1/ L2/ L5, GLONASS L1/ L2, Galileo E1/E5a/E5b/AltBOC and BeiDou B1/B2. This format is recommended when working exclusively with Leica instruments. CMR: CMR and CMR+ are compacted formats used to broadcast data for third-party instruments. RTCM 3.1, RTCM 3.2 MSM3, RTCM 3.2 MSM5: Use RTCM when rover units from a different manufacturer are to be used. Use to decode the standard RTCM v3 and the RTCM v3 (MSM) messages from the base. Message according to RTCM version 3. A new standard format for transmission of Global Navigation Satellite System correction infor-
mation. Higher efficiency than RTCM v2.x. Supports real-time services with significantly reduced bandwidth. Still in the RTK Settings screen define the time interval and the use for Time Slicing. When finished, confirm in the Save Settings screen. iCON gps 80, Software Tools 68 Step 10. 11. 12. 13. 14. 15. 16. 17. 18. Description For the External Radio P2 select On, Off or Edit and press When Edit was selected:
In the External Radio (1) screen select the Model:
For generic radio setting (Generic RS232), where no device is auto-
to confirm. detected, select Baud rate and Flow contr.. For external radios which are automatically detected, the Model is also selected automatically. In the External Radio (2) screen select the Channel. Protocol and FEC can be defined under Advanced Settings. For external radios which are not automatically detected, select the Model in the External Radio (1) screen and in the External Radio (2) screen select the Channel and the Protocol.
Protocol and FEC are available and the frequency can be set manu-
If a frequency is required that is not given as part of a channel, the In the RTK Settings screen select the Corr.Format from Leica, Leica 4G, CMR, RTCM 3.1, RTCM 3.2 MSM3, RTCM 3.2 MSM5. Refer to step 9. for details. ally just for the external GFU27 radio, when radio firmware version 06.17.3.61 or higher is installed. frequency can be typed in manually. If required the bandwidth can be changed as well. Still in the RTK Settings screen define the time interval and the use for Time Slicing. to confirm. In the Internet conn. screen select Modem or Ethernet as device. When finished, confirm in the Save Settings screen. For the Network select On, Off or Edit and press When Edit was selected:
To configure the settings for Modem continue with 12. To configure the settings for Ethernet continue with 35. In the Int. Modem screen select NTRIP Base, NTRIP Source, TCP Server, or Dialup as Mode. To configure the settings for NTRIP Base continue with 13. To configure the settings for NTRIP Source continue with 20. To configure the settings for TCP Server continue with 25. To configure the settings for Dialup continue with 32. In the Int. Modem screen select NTRIP Base as Mode, enter PIN, APN
(Access Point Name) and select Use/Don't use for the APN ID. When Use is selected:
Use the navigation key to proceed to the next step. In the APN ID screen enter User ID and Password. Use the navigation key to proceed to the next step. In the DynDNS Settings (for Dynamic Domain Name System) screen select the Provider and enter Host, Username and Password. the network provider. When using a SIM card with a fixed IP set DynDNS to Off.
The fixed IP functionality for a SIM card must explicitly be ordered at Use the navigation key to proceed to the next step. In the NTRIP Settings screen enter Port number, Username and Password.
The port number entered must be accessible from outside your local Use the navigation key to proceed to the next step. cell network. iCON gps 80, Software Tools 69 Step 19. 20. 21. 22. 23. 24. 25. 26. 27. 28. 29. 30. 31. 32. 33. 34. Description In the Save Settings screen select the Corr.Format (Correction Format). Refer to step 9. for details. Use the navigation key to save the settings and enable the device. In the Int. Modem screen select NTRIP Source as Mode, enter PIN, APN
(Access Point Name) and select Use/Don't use for the APN ID. When Use is selected:
Use the navigation key to proceed to the next step. In the APN ID screen enter User ID and Password. Use the navigation key to proceed to the next step. In the Caster Settings screen select the Mode and enter Address, Port, Mnt.Pt. (mount point) and Password. Address mode WWW allows the entry of a web address. Address mode IP allows the entry of an IP address. Use the navigation key to proceed to the next step. In the Save Settings screen select the Corr.Format (Correction Format). Refer to step 9. for details. Use the navigation key to save the settings and enable the device. In the Int. Modem screen select TCP Server as Mode, enter PIN, APN
(Access Point Name) and select Use/Don't use for the APN ID. When Use is selected:
Use the navigation key to proceed to the next step. In the APN ID screen enter User ID and Password. Use the navigation key to proceed to the next step. In the DynDNS Settings (for Dynamic Domain Name System) screen select the Provider and enter Host, Username and Password. cell network. the network provider. When using a SIM card with a fixed IP set DynDNS to Off.
The fixed IP functionality for a SIM card must explicitly be ordered at Use the navigation key to proceed to the next step. In the TCP Server screen enter Port number and a number for Max. clients.
The port number entered must be accessible from outside your local Use the navigation key to proceed to the next step. In the Save Settings screen select the Corr.Format (Correction Format). Refer to step 9. for details. Use the navigation key to save the settings and enable the device. In the Int. Modem screen select Dialup as Mode, and enter PIN. Use the navigation key to proceed to the next step. In the Save Settings screen select the Corr.Format (Correction Format). Refer to step 9. for details. Use the navigation key to save the settings and enable the device. iCON gps 80, Software Tools 70 Step 35. 36. 37. 38. 39. 40. 41. Description In the Ethernet screen select the Mode from NTRIP Base, NTRIP Source, and TCP Server. Set DHCP to:
On to use the DHCP (Dynamic Host Configuration Protocol) to automat-
ically get IP address and networking parameters requested from a DHCP server. Use the navigation key to proceed to the next step. In the IP Address screen use the Renew DHCP Lease functionality if necessary. Off to manually enter IP address and networking parameters. Use the navigation key to proceed to the next step. In the DNS Servers screen enter the primary and, if needed, the secondary DNS server parameters. number, Username and Password. Use the navigation key to proceed to the next step. When NTRIP Base was selected: In the NTRIP Settings screen enter Port
The port number entered must be accessible from outside your local When NTRIP Source was selected: In the Caster Settings screen select cell network. the Mode and enter Address, Port, Mnt.Pt. (mount point) and Pass-
word. Address mode WWW allows the entry of a web address. Address mode IP allows the entry of an IP address. cell network. number and a number for Max. clients. When TCP Server was selected: In the TCP Server screen enter Port
The port number entered must be accessible from outside your local Use the navigation key to proceed to the next step. In the Save Settings screen select the Corr.Format (Correction Format). Refer to step 9. for details. Use the navigation key to save the settings and enable the device. Use the navigation key to proceed to the Antenna 1 screen. The active Antenna, the Height of the active antenna, the Measure mode of antenna height and the Ref.Stn.ID (Reference Station Identification) might be changed. Refer to "3.8 Antenna Heights" for information about Antenna Heights. Use the navigation key to proceed to the final step. To save and apply the new Base Station settings select Save and press to confirm. To discard the new Base Station settings select Undo and press
. To actually discard the settings confirm the following Warning by pressing on OK. Edit step-by-step The Edit function can be used to enter a set of coordinates manually. Step 1. 2. Description According your needs, setup the hardware needed at the desired base point position. Refer to "4 Setups with Accessories" for further information about hardware setup. Access the wizard via Settings > Tools > Base Setup. iCON gps 80, Software Tools 71 Step 3. 4. 5. 6. 7. to confirm. Description In the Position screen highlight Modify and press Select Edit and press In the Edit Position screen enter a Point ID, a set of coordinates and the height of the desired Base Station. Select Continue and press to confirm. The instrument searches for base points in the vicinity, which are stored in the Base Point List. If there is already a Base Point within a 40 m radius of the measured point stored in the instrument a message is displayed:
Select Overwrite to use the newly measured position, or select Use existing to use the known point. In case the existing point has been chosen, a second warning message is displayed where you can choose between Saved setup to use the saved Base point setup, including Antenna and Communication settings, or Current to use the currently used Base point setup. If no Base Point is found within a 40 m radius an according information message is displayed and the newly entered information is stored as Base Point. 6.1.3 Base Setup using BasePilot BasePilot setup BasePilot is a feature which configures and starts the iCON gps 80 running as a Base when the instrument (antenna) is setup over a known base point. Predefined base configurations are automatically loaded. Step 1. 2. 3. 4. Description According to your needs, setup the hardware needed over a known base point. Refer to "4 Setups with Accessories" for further information about hardware setup. If iCON gps 80 is in Base mode:
BasePilot starts up automatically. If iCON gps 80 is in Rover mode:
Go to Settings > Tools > Base Setup and choose Find nearest. Press to confirm. Refer to "6.1.2 Manual Base Setup" for further information. While BasePilot is setting up: The position icon is displayed. After the BasePilot has been completed: The position icon The radio/modem now starts transmitting corrections!
is displayed.
On RTK Mode page, in the Position submenu the line BasePilot shows: Successful.
When using BasePilot, always check in the Position submenu that the iCON gps 80 has selected the correct base point! Using the wrong base point can lead to an error of more than 20 m for a rover!
iCON gps 80, Software Tools 72 6.2 Rover Setup Rover setup description The instrument can be manually set up as a stand-alone Rover without a controller, using the Rover Setup wizard. Step 1. 2. 3. Step 1. 2. 3. 4. Rover setup with internal radio step-
by-step Description Access the wizard via Settings > Tools > Rover Setup. In the Communication screen press device using the and navigation keys:
Int. Radio:
Select this option to use the internal radio. A slot-in-radio must be inserted in its slot. Refer to "3.3 Slot-in-Device" for further information. and select the communication Ext. Radio P2:
Select this option to use an external radio connected to Port P2. Select this option to use a NTRIP Bridge connected to Port P2. NTRIP Bridge P2:
A NTRIP Bridge may also be known as UMTS-CDMA router. Int. Modem:
Select this option to use the internal modem. A SIM card must be inserted in the card slot. Refer to "3.2 Installing a SIM Card" for further informa-
tion. Ethernet:
Select this option to use Ethernet. Press to the next step. to confirm your selection and use the navigation key to proceed
The following step-by-step descriptions explain the different options in detail. Description Access the wizard via Settings > Tools > Rover Setup. In the Communication screen select Int. Radio. Use the navigation key to proceed to the next step. In the Internal Radio (1) screen the Model is displayed. In the Internal Radio (2) screen select the Channel, Frequency, and Bandwidth. Protocol and FEC can be defined under Advanced Settings.
Protocol and FEC are available and the frequency can be set manu-
If a frequency is required that is not given as part of a channel, the ally just for an internal Satelline radio TA13, when radio firmware version 06.17.3.61 or higher is installed. frequency can be typed in manually. If required the bandwidth can be changed as well. 5. 6. 7. Use the navigation key to proceed to the next step. In the RTK Settings screen select the Corr.Format (Correction Format), the Ref.Rec. (Reference Receiver), the Ref.Ant. (Reference Antenna) and the Accept Ref. (Accepted References).
Refer to "RTK correction format" for further information about the Use the navigation key to proceed to the next step. correction formats. iCON gps 80, Software Tools 73 Rover setup with external radio step-
by-step Step 8. 9. 10. 11. Step 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. Description In the Antenna 1 screen select the active Antenna, the Height of the active antenna, and the Measure mode of antenna height. Refer to "3.8 Antenna Heights" for information about Antenna Heights. Use the navigation key to proceed to the final step. In the Save Settings screen the signal waves will flash if the Channel and the Corr.Format are correctly set. Use the navigation key to save and apply the rover settings. To discard the changes press and confirm the following Warning by pressing on Continue. Description Access the wizard via Settings > Tools > Rover Setup. In the Communication screen select Ext. Radio P2. Use the navigation key to proceed to the next step. In the External Radio (1) screen select the Model:
For generic radio setting (Generic RS232), where no device is auto-
detected, select Baud rate and Flow contr.. For external radios which are automatically detected, the Model is also selected automatically. In the External Radio (2) screen select the Channel and the Protocol. For external radios which are not automatically detected, select the Model in the External Radio (1) screen and in the External Radio (2) screen select the Channel and the Protocol.
Protocol and FEC are available and the frequency can be set manu-
If a frequency is required that is not given as part of a channel, the ally just for the external GFU27 radio, when radio firmware version 06.17.3.61 or higher is installed. frequency can be typed in manually. If required the bandwidth can be changed as well. correction formats. Use the navigation key to proceed to the next step. In the RTK Settings screen select the Corr.Format (Correction Format), the Ref.Rec. (Reference Receiver), the Ref.Ant. (Reference Antenna) and the Accept Ref. (Accepted Reference ID).
Refer to "RTK correction format" for further information about the Use the navigation key to proceed to the next step. In the Antenna 1 screen select the active Antenna, the Height of the active antenna, and the Measure mode of antenna height. Refer to "3.8 Antenna Heights" for information about Antenna Heights. Use the navigation key to proceed to the final step. In the Save Settings screen the signal waves will flash if the Channel and the Corr.Format are correctly set. Use the navigation key to save and apply the rover settings. To discard the changes press and confirm the following Warning by pressing on Continue. iCON gps 80, Software Tools 74 Rover setup with NTRIP Bridge step-
by-step Rover setup with internal modem using NTRIP Client step-by-step Step 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. Step 1. 2. 3. 4. 5. 6. 7. 8. Description Access the wizard via Settings > Tools > Rover Setup. In the Communication screen select NTRIP Bridge P2.
A NTRIP Bridge may also be known as UMTS-CDMA router. Use the navigation key to proceed to the next step. In the External Radio (1) screen select Baud rate, Parity and Flow contr.. Use the navigation key to proceed to the next step. In the RTK Settings screen select the Corr.Format (Correction Format), the Network type, the Ref.Rec. (Reference Receiver), and the Ref.Ant. (Refer-
ence Antenna).
Refer to "RTK correction format" for further information about the Use the navigation key to proceed to the next step. In the Antenna 1 screen select the active Antenna, the Height of the active antenna, and the Measure mode of antenna height. Refer to "3.8 Antenna Heights" for information about Antenna Heights. Use the navigation key to proceed to the final step. In the Save Settings screen the signal waves will flash if the Channel and the Corr.Format are correctly set. Use the navigation key to save and apply the rover settings. To discard the changes press and confirm the following Warning by correction formats. pressing on Continue. Description Access the wizard via Settings > Tools > Rover Setup. In the Communication screen select Int. Modem. Use the navigation key to proceed to the next step. In the Int. Modem screen select NTRIP Client as Mode, enter PIN, APN
(Access Point Name) and select Use/Don't use for the APN ID. When Use is selected:
Use the navigation key to proceed to the next step. In the APN ID screen enter User ID and Password. Use the navigation key to proceed to the next step. In the NTRIP Settings screen select the Address Mode, enter Address, Port number, User and Password. Address mode WWW allows the entry of a web address. Address mode IP allows the entry of an IP address. Use the navigation key to proceed to the next step. In the Mount Point screen select the Method. If the Method Source Table is selected, then start the mount point search by selecting Start in the Search line. Once the source table has been downloaded, the desired mount point can be selected from the list available in the Mountpoint line. If the Method Manual is selected, then it is possible to manually enter the mount point name. 9. Use the navigation key to proceed to the next step. iCON gps 80, Software Tools 75 Rover setup with internal modem using TCP Client step-by-step Step 10. 11. 12. 13. 14. 15. Step 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. correction formats. Description In the RTK Settings screen select the Corr.Format (Correction Format), the Network type, the Ref.Rec. (Reference Receiver), and the Ref.Ant. (Refer-
ence Antenna).
Refer to "RTK correction format" for further information about the Use the navigation key to proceed to the next step. In the Antenna 1 screen select the active Antenna, the Height of the active antenna, and the Measure mode of antenna height. Refer to "3.8 Antenna Heights" for information about Antenna Heights. Use the navigation key to proceed to the final step. In the Save Settings screen the signal waves will flash if the Channel and the Corr.Format are correctly set. Use the navigation key to save and apply the rover settings. To discard the changes press and confirm the following Warning by pressing on Continue. In the APN ID screen enter the User ID and the Password. Description Access the wizard via Settings > Tools > Rover Setup. In the Communication screen select Int. Modem. Use the navigation key to proceed to the next step. In the Int. Modem screen select TCP Client as Mode, enter PIN, APN (Access Point Name) and select Use/Don't use for the Provider ID. When Use is selected:
Use the navigation key to proceed to the next step. Use the navigation key to proceed to the next step. In the Server Settings screen select the Address Mode, enter Address and the Port number. Address mode WWW allows the entry of a web address. Address mode IP allows the entry of an IP address. Use the navigation key to proceed to the next step. In the RTK Settings screen select the Corr.Format (Correction Format), the Network type, the Ref.Rec. (Reference Receiver), and the Ref.Ant. (Refer-
ence Antenna).
Refer to "RTK correction format" for further information about the Use the navigation key to proceed to the next step. In the Antenna 1 screen select the active Antenna, the Height of the active antenna, and the Measure mode of antenna height. Refer to "3.8 Antenna Heights" for information about Antenna Heights. Use the navigation key to proceed to the final step. In the Save Settings screen the signal waves will flash if the Channel and the Corr.Format are correctly set. Use the navigation key to save and apply the rover settings. To discard the changes press and confirm the following Warning by correction formats. pressing on Continue. iCON gps 80, Software Tools 76 Rover setup with internal modem using DialUp step-
by-step Rover setup with Ethernet using NTRIP Client step-
by-step Step 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. Step 1. 2. 3. 4. Description Access the wizard via Settings > Tools > Rover Setup. In the Communication screen select Int. Modem. Use the navigation key to proceed to the next step. In the Int. Modem screen select Dialup as Mode, enter PIN and PUK. Use the navigation key to proceed to the next step. In the Dial-Up Settings screen enter the Ph. Number and select the Modem Prot., the Net Data Rate, and if the Connection should be transparent. Use the navigation key to proceed to the next step. In the RTK Settings screen select the Corr.Format (Correction Format), the Ref.Rec. (Reference Receiver), and the Ref.Ant. (Reference Antenna).
Refer to "RTK correction format" for further information about the Use the navigation key to proceed to the next step. In the Antenna screen select the active Antenna, the Height of the active antenna, and the Measure mode of antenna height. Refer to "3.8 Antenna Heights" for information about Antenna Heights. Use the navigation key to proceed to the final step. In the Save Settings screen the signal waves will flash if the Channel and the Corr.Format are correctly set. Use the navigation key to save and apply the rover settings. To discard the changes press and confirm the following Warning by correction formats. pressing on Continue. Description Access the wizard via Settings > Tools > Rover Setup. In the Communication screen select Ethernet. Use the navigation key to proceed to the next step. In the Ethernet screen select NTRIP Client as Mode. Set DHCP to:
On to use the DHCP (Dynamic Host Configuration Protocol) to automat-
ically get IP address and networking parameters requested from a DHCP server. Use the navigation key to proceed to the next step. In the IP Address screen use the Renew DHCP Lease functionality if necessary. Off to manually enter IP address and networking parameters. Use the navigation key to proceed to the next step. In the IP Address screen enter IP, Netmask, and Gateway. Use the navigation key to proceed to the next step. In the DNS Servers screen enter the primary and, if needed, the secondary DNS server parameters. 5. 6. 7. Use the navigation key to proceed to the next step. In the NTRIP Settings screen select the Address Mode, enter Address, Port number, User and Password. Address mode WWW allows the entry of a web address. Address mode IP allows the entry of an IP address. Use the navigation key to proceed to the next step. iCON gps 80, Software Tools 77 Step 8. 9. 10. 11. 12. 13. 14. 15. Step 1. 2. 3. 4. Rover setup with Ethernet using TCP Client step-by-step Description In the Mount Point screen select the Method. If the Method Source Table is selected, then start the mount point search by selecting Start in the Search line. Once the source table has been downloaded, the desired mount point can be selected from the list available in the Mountpoint line. If the Method Manual is selected, then it is possible to manually enter the mount point name. correction formats. Use the navigation key to proceed to the next step. In the RTK Settings screen select the Corr.Format (Correction Format), the Network type, the Ref.Rec. (Reference Receiver), and the Ref.Ant. (Refer-
ence Antenna).
Refer to "RTK correction format" for further information about the Use the navigation key to proceed to the next step. In the Antenna 1 screen select the active Antenna, the Height of the active antenna, and the Measure mode of antenna height. Refer to "3.8 Antenna Heights" for information about Antenna Heights. Use the navigation key to proceed to the final step. In the Save Settings screen the signal waves will flash if the Channel and the Corr.Format are correctly set. Use the navigation key to save and apply the rover settings. To discard the changes press and confirm the following Warning by pressing on Continue. Description Access the wizard via Settings > Tools > Rover Setup. In the Communication screen select Ethernet. Use the navigation key to proceed to the next step. In the Ethernet screen select TCP Client as Mode. Set DHCP to:
On to use the DHCP (Dynamic Host Configuration Protocol) to automat-
ically get IP address and networking parameters requested from a DHCP server. Use the navigation key to proceed to the next step. In the IP Address screen use the Renew DHCP Lease functionality if necessary. Off to manually enter IP address and networking parameters. Use the navigation key to proceed to the next step. In the IP Address screen enter IP, Netmask, and Gateway. Use the navigation key to proceed to the next step. In the DNS Servers screen enter the primary and, if needed, the secondary DNS server parameters. 5. 6. 7. Use the navigation key to proceed to the next step. In the Server Settings screen select the Address Mode, enter Address and the Port number. Address mode WWW allows the entry of a web address. Address mode IP allows the entry of an IP address. Use the navigation key to proceed to the next step. iCON gps 80, Software Tools 78 Step 8. 9. 10. 11. 12. 13. correction formats. Description In the RTK Settings screen select the Corr.Format (Correction Format), the Network type, the Ref.Rec. (Reference Receiver), and the Ref.Ant. (Refer-
ence Antenna).
Refer to "RTK correction format" for further information about the Use the navigation key to proceed to the next step. In the Antenna 1 screen select the active Antenna, the Height of the active antenna, and the Measure mode of antenna height. Refer to "3.8 Antenna Heights" for information about Antenna Heights. Use the navigation key to proceed to the final step. In the Save Settings screen the signal waves will flash if the Channel and the Corr.Format are correctly set. Use the navigation key to save and apply the rover settings. To discard the changes press and confirm the following Warning by pressing on Continue. RTK correction format Option Leica Leica 4G CMR / CMR+
RTCM 3.1 / 3.2 MSM, RTCM 2.3 18/19, RTCM 2.3 20/21 Description The proprietary Leica real-time GPS data format supporting GPS L1/L2 and GLONASS L1/ L2. The proprietary Leica real-time GNSS data format supporting GPS L1/ L2/ L5, GLONASS L1/ L2, Galileo E1/E5a/E5b/AltBOC and BeiDou B1/B2. This format is recommended when working exclusively with Leica instruments. CMR and CMR+ are compacted formats used to broadcast data for third-party instruments. Use RTCM when rover units from a different manufacturer are to be used. Use to decode the standard RTCM v3 and the RTCM v3
(MSM) messages from the base. RTCM 3.2 MSM supports GPS L1/ L2/ L5, GLONASS L1/ L2, Galileo E1/E5a/E5b/AltBOC and BeiDou B1/B2. Message according to RTCM version 3. A new standard format for transmission of Global Navigation Satellite System correction information. Higher efficiency than RTCM v2.x. Supports real-time services with significantly reduced bandwidth.
Both RTCM MSM3 and RTCM MSM5 are supported. RTCM MSM3 is a compact version of the format and is suitable for low bandwidth transmission. RTCM MSM5 is an extended version of the format. iCON gps 80, Software Tools 79 6.3 ORP and NMEA Output NMEA Output description To transmit data using the NMEA standard protocol, the instrument must be config-
ured accordingly. rates.
The appropriate position rate licences must be installed to access all output
Two NMEA interfaces can be active in parallel. The NMEA interfaces can be assigned to one of the serial ports, the Bluetooth port, a Net port via the Ethernet port, or via the modem. NMEA Output settings step-by-
step Step 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. Description Access the wizard via Settings > Tools > NMEA Output. In the NMEA Output screen select On, Off, or Edit for each NMEA interface. When the NMEA Output settings have been done before, select On or Off to active/deactivate the output and press to save the setting and return to the Tools menu. When the NMEA Output settings have not been done before, select Edit to start the NMEA Output wizard and confirm with Select the Port for the NMEA output. P1, P2, Bluetooth, TCP Server (over Ethernet) and UDP client (over Ethernet or modem) are supported. When using TCP Server:
To use a static IP the DHCP service must be turned off. This allows to set to confirm. Then press
. the IP manually. This must be done before configuring a NMEA stream over Ethernet. Go to Settings > System Configuration > Network Settings to turn DHCP Off and enter IP, Netmask, Gateway and DNS Servers. When using UDP Client:
Up to 100 hosts can be defined under Manage Hosts. All defined hosts are active in parallel. For the Talker ID select between Auto or User. When User is selected set the User Talker ID additionally. Finally select Baud rate and Flow contr.. Use the navigation key to proceed to the next step. For ORP, select Off, Edit, or set a rate. When Edit is selected: set the Rate, the Coords (coordinate format), and the Output position additionally. For Output, select between Pos 1 only, Pos 1 & 2 or Pos 1,2 & Hdg (N). The Height is set automatically according to the coordinate system used:
for WGS84 it is Ellipsoidal, and Orthometric for Local Grid. Refer to "Appendix B ORP Orientation and Position" for further informa-
tion about ORP. For GGA, GGK, GGQ, and GLL select Off or set a rate. Refer to "Appendix A NMEA Message Formats" for information about the different NMEA message formats. Use the navigation key to proceed to the next step. For GNS, GSA, GSV, HDT, and LLK select Off or set a rate. Refer to "Appendix A NMEA Message Formats" for information about the different NMEA message formats. Use the navigation key to proceed to the next step. iCON gps 80, Software Tools 80 Step 11. 12. 13. Description For LLQ, RMC, VTG, XDR, and ZDA select Off or set a rate. Refer to "Appendix A NMEA Message Formats" for information about the different NMEA message formats. Use the navigation key to proceed to the final step. To save the changes select Save and confirm with
. To discard the changes select Undo and confirm with
. ORP Output The ORP output differs from standard NMEA messages:
The ORP message is a Leica proprietary message and delivers position information of one or two antennas. In a two antenna setup the orientation between the antennas is calculated as well. This feature is only available for iCG82. Configurable values Rate: Define the output rate. Output: It is possible to stream the Master position (Pos 1) or Master and Slave positions (Pos 1 & 2). Using Pos 1,2 & Hdg (N) allows to stream Heading data as well. Available for WGS84 and when the coordinate system is set to Local Grid. Coords and Height: The available Height format depends on the selected Coordi-
nate format. For local coordinates a "*.lok", a "*.xml" or "TRFSET.DAT" file is required. ORP settings can be accessed via Settings > Tools > NMEA Output. Select the port you want ORP data to be output from (NMEA Out 1 or/and NMEA Out 2) and toggle to Edit. ORP is available on the second page of the wizard. Refer to "Appendix B ORP Orientation and Position" for further information about ORP. 6.4 Raw Data Logging Raw Data logging To log RINEX data the instrument must be configured for Raw Data logging. Access the settings via Settings > Tools > Raw Data Logging.
RINEX is used for post processing when high accurate coodinates are required. iCON gps 80, Software Tools 81 6.5 Description iCON Telematics first setup step-by-
step iCON Telematics With a connection between the instrument and the iCON telematics web page, iCON Telematics offers:
View: Enables a remote user to access the instrument to view or control it. Sync: To exchange data between the instrument and a remote web page. Track: Enables a remote user to track the current position of the instrument. Remote firmware upgrade: Allows new instrument firmware files to be down-
loaded and installed remotely.
To use this functionality an account is needed for the iCON telematics web page. The license is handled on the instrument. Ask your agency or your Leica Geosystems representative for information about licensing and how to get an account. to "3.2 Installing a SIM Card" for information about SIM card installation.
An Internet connection on the instrument is needed, using a 4G modem. Refer To use the iCON Telematics functionality perform following setup works in the given order:
Step 1. Description Establish an Internet connection on the instrument, following these steps:
Refer to "3.2 Installing a SIM Card" for information about SIM card Access the wizard via Settings > Tools > iCON Telematics > iCON Tele-
installation. matics Setup. In the Internet conn. screen select Modem or Ethernet as device. For an Internet connection using Modem:
In the Int. Modem screen enter PIN and APN (Access Point Name) and select Use/Don't use for the APN ID. When Use is selected:
Use the navigation key to proceed to the next step. In the APN ID screen enter User ID and Password. For an Internet connection using Ethernet:
Set DHCP to:
On to use the DHCP (Dynamic Host Configuration Protocol) to auto-
matically get IP address and networking parameters requested from a DHCP server. Use the navigation key to proceed to the next step. In the IP Address screen use the Renew DHCP Lease functionality if necessary. Off to manually enter IP address and networking parameters. Use the navigation key to proceed to the next step. In the IP Address screen enter IP, Netmask, and Gateway. Use the navigation key to proceed to the next step. In the DNS Servers screen enter the primary and, if needed, the secondary DNS server parameters. iCON gps 80, Software Tools 82 2. 3. 4. Step Description Use the navigation key to proceed to the next step. Ensure that Server is set to icontelematics.com. Select Start pairing ... and press The software starts connecting to the selected Web page. After a to confirm. successful connection the pairing code is displayed. Be sure to leave this screen open or note down the code.
In case of failure, check PIN and APN. Pair the instrument to the iCON telematics web page.
This is only necessary for the first time the instrument is connected to the iCON telematics web page. On the remote computer:
Start a web-browser. Google Chrome is recommended for best perfor-
mance. Go to the iCON telematics web page: www.icontelematics.com. Use your User name and Password to login.
To use this functionality an account is needed for the iCON telem-
atics web page. The license is handled on the instrument. Ask your agency or your Leica Geosystems representative for information about licensing and how to get an account. Now create a new Unit:
Select the Company or create a new one. Select the Project, that the Unit should be assigned to. If no project is available, create a project first. Tap Configure, and select Units. Tap the + icon. Enter the desired Unit Name and select the Unit Type. If desired, use Note to enter additional information. Tap Next. Set Equipment Type to GNSS Machine Receiver. Tap Add Equip-
ment to create a Unit with the current settings. To pair the instrument and the created (Web) Unit, enter the pairing code and tap Pair. On the instrument:
The screen with the pairing code should have been replaced by a confir-
mation that the instrument is paired with the server. The device is now paired/registered on the web page, and ready to connect. Use the navigation key to proceed to the next step. In the Telematics Project screen the selected Project is highlighted. If needed, select another project from the list. Use the navigation key to proceed to the next step. To allow to send the position of the paired instrument to the iCON tele-
matics web page, set Track to Yes. Select the Interval as well in the Tele-
matics Track screen. Use the navigation key to proceed to the next step. In the Save Settings screen use the navigation key to save the settings and exit the setup.
The device is connected to the iCON telematics web page now and ready for View, Sync and Track. Information about the different functions can be found on the following paragraphs. iCON gps 80, Software Tools 83 iCON Telematics Status Use Settings > Tools > iCON Telematics > iCON Telematics Status to:
enable or disable the Share screen function, to allow a remote user to view the instruments screen, view the status of iCON Telematics and its functions View, Track and Sync. iCON Sync Download 1) To download data from the iCON telematics web page to the instrument select Settings > Tools > iCON Telematics > iCON Sync Download. 2) Set Base Point List, Coord. Systems, Antenna List, and Licenses according to your needs. 3) Use the navigation key to proceed to the next step. 4) Select Start Download ... and press
Base point list, system configuration, antenna list and licences are automati-
cally available after import on the instrument. The imported coordinate systems can be selected under Settings > System Configuration > Coordinate systems as active coordinate system. to confirm.
When copying files onto the iCON telematics server via the web page, it is important that the files are copied to the following folders: Base point list must be stored in System, while Coordinate systems must be stored in CoordinateSystems/. iCON Sync Upload 1) To upload data from the instrument to the iCON telematics web page select Settings > Tools > iCON Telematics > iCON Sync Upload. 2) Set Base Point List, System Config, Coord. Systems, Support Logs, and Raw Data Logs according to your needs. 3) Use the navigation key to proceed to the next step. 4) Select Start Upload ... and press to confirm. Uploaded data will be stored on the iCON telematics web page, inside the assigned project folder:
The base point list will be stored at System/iCG81-SN.bpl. The system configuration will be stored at System/iCG81-SN.cfg. Coordinate systems will be stored at CoordinateSystems/. Support Logs will be stored at Logging/logs-iCG81-SN/ and deleted from the instrument after successful upload. on the instrument after successful upload. Raw Data Logs will be stored at Logging/RINEX-iCG81-SN-yyyyMMdd and be kept
iCG81 will be replaced by iCG82, if a iCG82 instrument is used.
SN stands for the Serial Number of the instrument, yyyyMMdd for the logging date. iCON gps 80, Software Tools 84 iCON Telematics Firmware 1) To download a firmware version from the iCON telematics web page and install it on the instrument select Settings > Tools > iCON Telematics > iCON Telematics Firmware. 2) The software searches for available firmware on the iCON telematics web page. 3) If successful, select the firmware version needed, select Start download ... and press to confirm. installation. to start installation. 4) When download is completed, select Install and press
Ensure a proper power supply as the instrument will restart after the firmware
If iCON Telematics is enabled, the icon on the Main Menu automatically informs when a new firmware is available. Download and installation of the new firmware can also be started from within the iCON Telematics sub-menu, entered from the Main Menu. iCON Telematics settings step-by-
step Step 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. Description Access the wizard via Settings > Tools > iCON Telematics > iCON Telem-
atics Setup. In the Internet conn. screen, use the navigation key to proceed to the next step. In the Int. Modem screen enter PIN and APN (Access Point Name) and select Use/Don't use for the APN ID. When Use is selected:
Use the navigation key to proceed to the next step. In the APN ID screen enter User ID and Password. Use the navigation key to proceed to the next step. Ensure that Server is set to icontelematics.com. If required, select Pair again ... and press to confirm. After a successful connection, an appropriate message is displayed. Otherwise skip this step. Use the navigation key to proceed to the next step. In the Telematics Project screen select a Project from the list.
System configuration, coordinate systems, support and raw data logfiles are stored within the selected project on the iCON telematics web page when using iCON Sync Upload. Use the navigation key to proceed to the next step. To allow to send the position of the paired instrument to the iCON tele-
matics web page, set Track to Yes. Select the Interval. Use the navigation key to proceed to the next step. In the Save Settings screen use the navigation key to save the settings and exit the setup. iCON gps 80, Software Tools 85 6.6 Import, Export, or Delete Data Access the Import /
Export / Delete function Select Settings > Tools > Import / Export / Delete to import or export data from/to a USB Memory device installed in the instruments USB port or to delete data from the instruments internal memory. Import data from USB Select Settings > Tools > Import / Export / Delete > Import from USB to import data from a USB Memory device installed in the instruments USB port. Import options Base point list Antenna list Welcome screen System configuration Coordinate systems Description imports a list of base points imports a list of external antennas imports a customisable welcome screen, for example a company logo overwrites the current system configuration imports coordinate system files
To import data from a USB Memory device to the instrument appropriate folders must be created on the USB device and the files placed in the correct folder: for Coordinate Systems a folder called CoordinateSystems is needed, while files for Base Point list, Antenna list, Welcome Screen, and System Configuration need to be placed in a system folder. Export data to USB Select Settings > Tools > Import / Export / Delete > Export to USB to export data to a USB Memory device installed in the instruments USB port. Export options Base point list System configuration Support logs Coordinate systems Description exports a list of stored base points generates a backup of the current system configuration, for example to restore it in the future or to share settings to other instruments instrument related error messages are stored in the log file and can be exported exports coordinate system files device. The appropriate folders are automatically created by the software.
To export data to a USB Memory device no folders must be created on the Select Settings > Tools > Import / Export / Delete > Delete on instrument to delete data from the instruments internal memory. Delete data on the instrument Delete options Base point list Welcome screen Support logs Coordinate systems Description deletes the list of stored base points deletes the customised welcome screen removes all entries from the Support Log File removes all Coordinate systems stored on the instrument iCON gps 80, Software Tools 86 6.7 Licences Licensing In the Licensing menu active licenses can be viewed or deleted, licenses can be uploaded and a license key entered. Access the settings via Settings > Tools >
Licenses. Licenses can be ordered at your local sales representative. The following options are available for iCON gps 80:
CSW560, RTK low Accuracy (Hz) CSW561, RTK high Accuracy (Hz) CSW562, Enables Base Station CSW563, Position update 2 Hz CSW564, Position update 20 Hz CSW565, RTK Baseline optional 2.5 km CSW566, RTK unlimited Baseline CSW567, RTK Network access CSW568, GPS L2 Support CSW569, GLONASS Support CSW570, GPS L5 Support CSW571, Galileo Support CSW572, BeiDou Support CSW574, NMEA streaming CSW575, Open Interface License CSW576, Dual Position / Heading CSW577, Demo License CSW596, iCON telematics 1 Year CSW597, iCON telematics 2 Years CSW598, iCON telematics 3 Years CSW599, iCON telematics 1 Day CSW900, iCON telematics additional 1 Year CSW901, RTK low Accuracy (2D) CSW902, RTK low Accuracy Heading, for iCG82 CSW903, Upgrade to Precise Heading CSW905, SmartLink Service 2 Years iCON gps 80, Software Tools 87 7 Description Coordinate Systems GNSS measured points are always stored based on the global geocentric datum known as WGS 1984. Most surveys require coordinates in a local grid system. For example, based on a countrys official mapping datum or an arbitrary grid system used in a particular area such as a construction site. To convert the WGS 1984 coordinates into local coordinates a coordinate system must be created. Part of the coordinate system is the transformation used to convert coordinates from the WGS 1984 datum to the local datum. A coordinate system allows the conversion from WGS 1984 geodetic or cartesian coordinates to local grid coordinates and back. can be directly received from a reference network. can be uploaded from a USB Memory device. can be exported to a USB Memory device. Default coordinate systems exporting, or deleting coordinate systems.
Refer to "6.6 Import, Export, or Delete Data" for information about importing, The default coordinate system is WGS 1984. It cannot be deleted. It is not possible to create a coordinate system called WGS 1984. Additional default coordinate systems may be available for certain countries. Active coordinate system The active coordinate system is the one selected under Settings > System Configura-
tion > Coordinate systems. One coordinate system is always considered as the active coordinate system. Automatic coordi-
nate system (RTCM transformation parameters) When Via Network is selected under Settings > System Configuration > Coordinate systems, the coordinate system is directly received from the reference network via RTCM correction data.
Reference networks do not always provide a coordinate system. This will depend on how the network provider has chosen to configure their data streams. Coordinate system components The iCON gps 80 supports the same coordinate system formats as other Leica iCON products including iCON 3D, iCON Office, iCONstruct field software, as well as Leica RedLine and GNSS Leica Viva sensors. Coordinate systems can be made up of up to three linked files:
.lok: Localisation file, contains all the needed parameters and settings, for example datum, map projection and local transformation. ccg: Correction grid (Country Specific Coordinate System model). Refer to "CSCS model (*.ccg)" for information about CSCS. grd: Geoid model. Refer to "Geoid model" for further information. TRFSET.DAT files can also be imported and used on the iCON gps 80. TRFSET.DAT: Localisation file, contains all the needed parameters and settings, for example datum, map projection and local transformation. csc: Correction grid (Country Specific Coordinate System model). gem: Geoid model.
TRFSET.DAT files are read only and cannot be exported in .lok or .xml format. iCON gps 80, Coordinate Systems 88 8 8.1 Care and Transport Transport Transport in the field When transporting the equipment in the field, always make sure that you either carry the product in its original transport container, or carry the tripod with its legs splayed across your shoulder, keeping the attached product upright. Transport in a road vehicle Never carry the product loose in a road vehicle, as it can be affected by shock and vibration. Always carry the product in its transport container, original packaging or equivalent and secure it. Shipping When transporting the product by rail, air or sea, always use the complete original Leica Geosystems packaging, transport container and cardboard box, or its equivalent, to protect against shock and vibration. Shipping, transport of batteries When transporting or shipping batteries, the person responsible for the product must ensure that the applicable national and international rules and regulations are observed. Before transportation or shipping, contact your local passenger or freight transport company. 8.2 Product Storage Respect the temperature limits when storing the equipment, particularly in summer if the equipment is inside a vehicle. Refer to " Environmental specifications" for informa-
tion about temperature limits. 8.3 Cleaning and Drying Product and acces-
sories Use only a clean, soft, lint-free cloth for cleaning. If necessary, moisten the cloth with water or pure alcohol. Do not use other liquids; these may attack the polymer components. Damp products Dry the product, the transport container, the foam inserts and the accessories at a temperature not greater than 40C/104F and clean them. Remove the battery cover and dry the battery compartment. Do not repack until everything is dry. Always close the transport container when using in the field. Cables and plugs Keep plugs clean and dry. Blow away any dirt lodged in the plugs of the connecting cables. Connectors with dust caps Wet connectors must be dry before attaching the dust cap. iCON gps 80, Care and Transport 89 9 9.1 9.1.1 Technical Data Technical Data iCON gps 80 Tracking Characteristics Instrument tech-
nology SmartTrack Satellite reception Triple frequency Instrument chan-
nels Supported codes and phases
Depending on the satellite systems and signals configured, a maximum number of 120 channels is allocated. GPS Type iCON gps 80 GLONASS Type iCON gps 80 Galileo Type iCON gps 80 BeiDou Type iCON gps 80 L1 Carrier phase, C/A-
code L2 Carrier phase, C code (L2C) and P2-
code L5 Carrier phase, code L1 Carrier phase, C/A-code L2 Carrier phase, P2-code E1 Carrier phase, code E5a Carrier phase, code E5b Carrier phase, code AltBOC Carrier phase, code B1 Carrier phase, code B2 Carrier phase, code
Carrier phase and code measurements on L1, L2 and L5 (GPS) are fully independent with AS on or off. Satellites tracked Up to 60 satellites simultaneously on two frequencies iCON gps 80, Technical Data 90 9.1.2
Accuracy Accuracy is dependent upon various factors including the number of satellites tracked, constellation geometry, observation time, ephemeris accuracy, ionospheric distur-
bance, multipath and resolved ambiguities. The following accuracies, given as root mean square, are based on measurements processed using LGO and on real-time measurements. The use of multiple GNSS systems can increase accuracy by up to 30% relative to GPS only. Differential code The baseline precision of a differential code solution for static and kinematic surveys is 25 cm. Differential phase in post-processing Static and rapid static Static Horizontal 5 mm + 0.5 ppm Static with long observations Vertical 10 mm + 0.5 ppm Kinematic Horizontal 10 mm + 1 ppm Vertical 20 mm + 1 ppm Static Horizontal 3 mm + 0.1 ppm Vertical 3.5 mm + 0.4 ppm 10 mm + 1 ppm Kinematic Horizontal Vertical 20 mm + 1 ppm Differential phase in real-time Precise Heading Type Single Baseline (<30 km) Network RTK Horizontal 8 mm + 1 ppm 8 mm + 0.5 ppm Vertical 15 mm + 1 ppm 15 mm + 0.5 ppm Heading accuracy with 1 m antenna separation: 0.18 2 m antenna separation: 0.09 5 m antenna separation: 0.05 iCON gps 80, Technical Data 91 9.1.3 General Technical Data of the Instrument Dimensions The overall dimensions are given for the housing including the sockets. 153.5 mm m m 5
. 4 1 2 m m 0 9 m m 5
. 5 8 184.8 mm Width [mm]
184.8 Thickness [mm]
85.5 144.8 mm 165 mm 005688_001 Length [mm]
214.5 Weight Type iCG81 iCG82 Weight [kg]/[lbs]
2.20/4.85 (including internal LTE modem) 2.25/4.96 (including internal LTE modem)
The internal modem is installed by default. Recording Data (Leica GNSS raw data and RINEX data) can be recorded on the internal memory. Capacity [MB]
466 Data capacity 466 MB is typically sufficient for about GPS only (12 satellites) 3600 h L1 + L2 + L5 data logging at 15 s rate 14000 h L1 + L2 + L5 data logging at 60 s rate GPS + GLONASS (12/8 satellites) 3100 h data logging at 15 s rate 12300 h data logging at 60 s rate Power Power consumption:
External supply voltage:
iCON gps 80 (Single GNSS), NTRIP Rover, radio excluded:
8.0 W typically, 24 V @ 333 mA iCON gps 80 (Dual GNSS), NTRIP Rover, radio excluded:
11. W typically, 24 V @ 475 mA Nominal 24 V DC (
supplied by:
9 V to 36 V DC power supply (machine or vehicle) via a
), voltage range 9 V to 36 V DC, converter cable supplied by Leica Geosystems, or GEB371 battery connected via a cable, or 110 V/240 V AC to 12 V DC power supply unit, supplied by Leica Geosystems. iCON gps 80, Technical Data 92 Battery external Electrical data Type:
Voltage:
Capacity:
Type Voltage Current Frequency Gain Noise Figure NiMH 13 V GEB371: 16.6 Ah iCON gps 80 Nominal 24 V Single GNSS: 8.0 W typically, 24 V @ 333 mA Dual GNSS: 11.0 W typically, 24 V @ 475 mA GPS L1 1575.42 MHz GPS L2 1227.60 MHz GPS L5 1176.45 MHz GLONASS L1 1602.5625 MHz - 1611.5 MHz GLONASS L2 1246.4375 MHz - 1254.3 MHz Galileo E1 1575.42 MHz Galileo E5a 1176.45 MHz Galileo E5b 1207.14 MHz Galileo Alt-BOC 1191.795 MHz BeiDou B1 1561.098 MHz BeiDou B2 1207.14 MHz BeiDou B3 1268.52 MHz Bluetooth 2400 MHz - 2483.5 MHz Typically 27 dBi Typically < 2 dBi
Pulse Per Second
(PPS)
For corresponding information for optional, internal radios refer to their spec-
ifications. Galileo AltBOC covers bandwidth of Galileo E5a and E5b. Type Peak Pulse length Positive/Negative Edge Connector Typical PPS pulse accuracy iCON gps 80 5.0 V 1 ms Selectable on display LEMO HMI.1B.308.YLWP 50 ns (120 ns 3) iCON gps 80, Technical Data 93 Environmental specifications Temperature Type Instrument Protection against water, dust and sand Operating temperature [C] Storage temperature [C]
-40 to +65
-55 to +85 Type Instrument Humidity Type Instrument Protection IP67 (IEC 60529) Dust tight Waterproof to 1 m temporary immersion Protection Up to 100 %
The effects of condensation are to be effectively counteracted by periodically drying out the instrument. Vibration/Shock Type Vibration Shock iCON gps 80 5 - 5000 Hz, 1.5 mm, 0.7 g IEC60068-2-6 MIL-STD 810G - 514.6E-1-Cat24 MIL-STD 810G - 514.6C-3-Cat4 60 g, 6 ms, IS09022 CGA60 10 - 10000 Hz, 1.5 mm, 10 g 8 - 150 Hz, 15 mm, 15 g ISO9022-36-08 MIL-STD 810F 514.5-Cat24 100 g, 2 ms 9.2 Antennas Technical Data Description and use The GNSS antenna is selected for use based upon the application. The table gives a description and the intended use of the antenna. Description GPS, GLONASS, Galileo, BeiDou SmartRack+ antenna with built-
in ground plane. Use Machine Control, RTK Base Station, RTK Rover and Network RTK applications. CGA60 62 mm 170 mm Type CGA60 Type Height Diameter TNC female 5/8" Whitworth 0.4 kg Dimensions Connector Mounting Weight iCON gps 80, Technical Data 94 Electrical data
Environmental specifications Vibration/Shock Type Voltage Current Frequency GPS L1 GPS L2 GPS L5 GLONASS L1 GLONASS L2 Galileo E1 Galileo E5a Galileo E5b Galileo AltBOC BeiDou B1 BeiDou B2 BeiDou B3 Gain (typically) Noise Figure (typically) CGA60 4.5 V to 18 V DC 35 mA typical 1575.42 MHz 1227.60 MHz 1176.45 MHz 1602.5625 - 1611.5 MHz 1246.4375 - 1254.3 MHz 1575.42 MHz 1176.45 MHz 1207.14 MHz 1191.795 MHz 1561.098 MHz 1207.14 MHz 1268.52 MHz 27 dBi
< 2 dBi Galileo AltBOC covers bandwidth of Galileo E5a and E5b. Temperature Type CGA60 Protection against water, dust and sand Operating temperature [C] Storage temperature [C]
-40 to +70
-55 to +85 Type CGA60 Humidity Type CGA60 Type Vibration Shock Protection IP67 (IEC 60529) Dust tight Protected against water jets Waterproof to 1 m temporary immersion Protection Up to 100 %
The effects of condensation are to be effectively counter-
acted by periodically drying out the antenna. CGA60 10 - 10000 Hz, 1.5 mm, 10 g 8 - 150 Hz, 15 mm, 15 g ISO9022-36-08 MIL-STD 810F 514.5-Cat24 100 g, 2 ms iCON gps 80, Technical Data 95 Cable length Separation distance from instrument ... iCON gps 80 to antenna CGA60 Optional cable lengths [m]
2.8, 5, 10 9.3 Pin Assignments and Sockets Expert knowledge required WARNING Port 2- Lemo 1 2 3 4 005700_001 8 7 6 5 USB 2.0 host connector 1 2 005713_001 Port 1- Lemo 1 2 3 4 005701_001 4 3 8 7 6 5 Modification or adaption on base of the pin assignments and socket descriptions need expert knowledge. Changes or modifications not expressly approved by Leica Geosystems for compliance could void the user's authority to operate the equipment. Pin 1 2 3 4 5 6 7 8 Name RTS CTS GND RxD TxD ID NC
+12 V out Function RS232, Request To Send RS232, Clear To Send Signal Ground RS232, receive data RS232, transmit data Identification pin Not connected 12 V DC power supply out Direction Out In
-
In Out In
-
Out Type: USB-A receptacle Pin 1 2 3 4 Name
+5V D-
D+
GND Function
+5V Power supply Data signal negative Data signal positive Power supply return and signals reference In Direction Out In/Out In/Out Picture: Receptacle viewed from mating side. Pin 1 2 3 4 5 6 7 8 Name RTS CTS Vin-
RxD TxD PPS Vin+
NC Function RS232, Request To Send RS232, Clear To Send Ground RS232, receive data RS232, transmit data Pulse per Second Power in, 9 V to 36 V DC Not connected Direction Out In
-
In Out Out In
-
iCON gps 80, Technical Data 96 CAN1, CAN2 Type: CAN M12 5 Pin 2 3 005702_001 Ethernet 3 2 005703_001 1 5 4 4 1 ANT1, ANT2, RADIO, MODEM 2 1 005704_001 Pin 1 2 3 4 5 Name Vcan+
CANH Vcan-
CANL CANON Type: M12 4 Pin Pin 1 2 3 4 Name Rx+
Tx+
Rx-
Tx-
Type: TNC Female Function Input power/ bus supply CAN high Ground CAN low Internal signal, reserved for machine system check Function Receive data +
Transmit data +
Receive data -
Transmit data -
Direction In/Out Bus
-
Bus
-
Direction In +
Out +
In -
Out -
Pin Description 1 2 Antenna signal and antenna power Shield/Ground
Connecting the wrong antenna to the wrong connector may cause damage to the antennas. In order to minimise the chance of connecting the incorrect external antenna, the four TNC connectors are colour coded. Cables with corre-
sponding colours are available. The colour coding is as follows:
a b 006150_001 c d a) White: Radio b) Black: Modem c) Blue: GNSS Antenna 1 d) Red: GNSS Antenna 2 iCON gps 80, Technical Data 97 9.4 9.4.1 Conformity Declarations iCON gps 80 Conformity to national regulations FCC Part 15, 22, 24 and 27 (applicable in US) Hereby, Leica Geosystems AG, declares that the product iCON gps 80 is in compli-
ance with the essential requirements and other relevant provisions of Directive 1999/5/EC. The declaration of conformity can be consulted at http://www.leica-
geosystems.com/ce. Class 1 equipment according European Directive 1999/5/EC (R&TTE) can be placed on the market and be put into service without restric-
tions in any EEA member state. The conformity for countries with other national regulations not covered by the FCC part 15, 22, 24 and 27 or European directive 1999/5/EC has to be approved prior to use and operation. Japanese Radio Law and Japanese Telecommunications Business Law Compliance. This device is granted pursuant to the Japanese Radio Law (
) and the Japa-
nese Telecommunications Business Law (
). This device should not be modified (otherwise the granted designation number will become invalid). Frequency band Type Bluetooth WCDMA GSM Frequency band [MHz]
2402 - 2480 WCDMA 2100 Tx: 1920 - 1980 Rx: 2110 - 2170 WCDMA 1900 Tx: 1850 - 1910 Rx: 1930 - 1990 WCDMA 850 Tx: 824 - 849 Rx: 869 - 894 WCDMA 800 Tx: 830 - 840 Rx: 875 - 885 WCDMA 900 Tx: 880 - 915 Rx: 925 - 960 GSM 850 Tx: 824 - 849 Rx: 869 - 894 EGSM 900 Tx: 880 - 915 Rx: 925 - 960 GSM 1800 Tx: 1710 - 1785 Rx: 1805 - 1880 GSM 1900 Tx: 1850 - 1910 Rx: 1930 - 1990 iCON gps 80, Technical Data 98 Type LTE Type Bluetooth UMTS GSM / EDGE LTE Output power Frequency band [MHz]
Band 1 Tx: 1920 - 1980 Rx: 2110 - 2170 Band 3 Tx: 1710 - 1785 Rx: 1805 - 1880 Band 7 Tx: 2500 - 2570 Rx: 2620 - 2690 Band 8 Rx: 880 - 915 Tx: 925 - 960 Band 20 Rx: 791 - 821 Tx: 832 - 862 Output power [mW]
2.5 Band 1, 2, 5, 8: 200 GSM 850, EGSM 900:
GMSK mode: 1585 8PSK mode: 500 GSM 1800, GSM 1900:
GMSK mode: 795 8PSK mode: 400 Band 1, 3, 8, 20: 200 Band 7: 160 Antenna Type Antenna type Connector Bluetooth CA26 Integrated antenna -
External stub antenna TNC (CA22, Magnetic antenna mount) Frequency band
[MHz]
2402 - 2480 698 - 2700 Specific Absorption Rate (SAR) The product meets the limits for the maximum permissible exposure of the guide-lines and standards which are force in this respect. The product must be used with the recommended antenna. A separation distance of at least 20 centimetres should be kept between the antenna and the body of the user or nearby person within the intended application. iCON gps 80, Technical Data 99 9.4.2 GFU14, SATEL Satelline 3AS, GFU27, SATEL Satelline M3-TR1 Conformity to national regulations FCC Part 15 and 90 (applicable in US) Hereby, Leica Geosystems AG, declares that the product GFU14, GFU27 is in compli-
ance with the essential requirements and other relevant provisions of Directive 1999/5/EC and other applicable European Directives. The declaration of conformity can be consulted at http://www.leica-geosystems.com/ce. This Class 2 equipment may be operated in: AT, BE, CY, CZ, DK, EE, FI, FR, DE, GR, HU, IE, IT, LV, LT, LU, MT, NL, PL, PT, SK, SI, ES, SE, GB, IS, LI, NO, CH, BG, RO and TR. Class 2 equipment according European Directive 1999/5/EC
(R&TTE) for which following EEA Member States apply restrictions on the placing on the market or on the putting into service or require authorisation for use:
Russia Ukraine (max. 10 mW output power, 433.050 -
434.790 MHz) Georgia Serbia The conformity for countries with other national regulations not covered by the FCC part 15 and 90 or European directive 1999/5/EC has to be approved prior to use and operation. Japanese Radio Law and Japanese Telecommunications Business Law Compliance. This device is granted pursuant to the Japanese Radio Law (
) and the Japa-
nese Telecommunications Business Law (
). This device should not be modified (otherwise the granted designation number will become invalid). Frequency band 403 MHz - 470 MHz Output power GFU14, GFU27:
0.5 W - 1.0 W Antenna Type Frequency band [MHz]
Type Connector GAT1 400 - 435 Detachable /2 antenna TNC GAT2 435 - 470 Detachable /2 antenna TNC Specific Absorption Rate (SAR) The product meets the limits for the maximum permissible exposure of the guide-lines and standards which are force in this respect. The product must be used with the recommended antenna. A separation distance of at least 20 centimetres should be kept between the antenna and the body of the user or nearby person within the intended application. iCON gps 80, Technical Data 100 9.4.3 GFU15, Pacific Crest PDL Conformity to national regulations FCC Part 15 and 90 (applicable in US) Hereby, Leica Geosystems AG, declares that the product GFU15 is in compliance with the essential requirements and other relevant provisions of Directive 1999/5/EC and other applicable European Directives. The declaration of conformity can be consulted at http://www.leica-geosystems.com/ce. This Class 2 equipment may be operated in: AT, BE, CY, CZ, DK, EE, FI, FR, DE, GR, HU, IE, IT, LV, LT, LU, MT, NL, PL, PT, SK, SI, ES, SE, GB, IS, LI, NO, CH, BG, RO and TR. Class 2 equipment according European Directive 1999/5/EC
(R&TTE) for which following EEA Member States apply restrictions on the placing on the market or on the putting into service or require authorisation for use:
Russia Ukraine (max. 10 mW output power, 433.050 -
434.790 MHz) Georgia Serbia The conformity for countries with other national regulations not covered by the FCC part 15 and 90 or European directive 1999/5/EC has to be approved prior to use and operation. Japanese Radio Law and Japanese Telecommunications Business Law Compliance. This device is granted pursuant to the Japanese Radio Law (
) and the Japa-
nese Telecommunications Business Law (
). This device should not be modified (otherwise the granted designation number will become invalid). Frequency band 403 MHz - 470 MHz Output power Receive only Antenna Type Frequency band [MHz]
Type Connector GAT1 400 - 435 Detachable /2 antenna TNC GAT2 435 - 470 Detachable /2 antenna TNC Specific Absorption Rate (SAR) The product meets the limits for the maximum permissible exposure of the guide-lines and standards which are force in this respect. The product must be used with the recommended antenna. A separation distance of at least 20 centimetres should be kept between the antenna and the body of the user or nearby person within the intended application. iCON gps 80, Technical Data 101 9.4.4 Intuicom 1200DL Conformity to national regulations FCC Part 15 and 90 (applicable in US) Hereby, Leica Geosystems AG, declares that the product 1200DL is in compliance with the essential requirements and other relevant provisions of Directive 1999/5/EC and other applicable European Directives. The declaration of conformity can be consulted at http://www.leica-geosystems.com/ce. This Class 2 equipment may be operated in: AT, BE, CY, CZ, DK, EE, FI, FR, DE, GR, HU, IE, IT, LV, LT, LU, MT, NL, PL, PT, SK, SI, ES, SE, GB, IS, LI, NO, CH, BG, RO and TR. Class 2 equipment according European Directive 1999/5/EC
(R&TTE) for which following EEA Member States apply restrictions on the placing on the market or on the putting into service or require authorisation for use:
Russia Ukraine (max. 10 mW output power, 433.050 -
434.790 MHz) Georgia Serbia The conformity for countries with other national regulations not covered by the FCC part 15 and 90 or European directive 1999/5/EC has to be approved prior to use and operation. Japanese Radio Law and Japanese Telecommunications Business Law Compliance. This device is granted pursuant to the Japanese Radio Law (
) and the Japa-
nese Telecommunications Business Law (
). This device should not be modified (otherwise the granted designation number will become invalid). Frequency band 902 MHz - 928 MHz Output power 5 mW - 1 W Antenna Type Frequency band [MHz]
Type Connector CA6 902 - 928 Detachable /2 antenna TNC (CA22, Magnetic antenna mount) CA26 698 - 2700 External stub antenna TNC (CA22, Magnetic antenna mount) iCON gps 80, Technical Data 102 9.4.5 TFR-300L Conformity to national regulations FCC Part 15 and 90 (applicable in US) Hereby, Leica Geosystems AG, declares that the product TFR-300L is in compliance with the essential requirements and other relevant provisions of Directive 1999/5/EC and other applicable European Directives. The declaration of conformity can be consulted at http://www.leica-geosystems.com/ce. This Class 2 equipment may be operated in: AT, BE, CY, CZ, DK, EE, FI, FR, DE, GR, HU, IE, IT, LV, LT, LU, MT, NL, PL, PT, SK, SI, ES, SE, GB, IS, LI, NO, CH, BG, RO and TR. Class 2 equipment according European Directive 1999/5/EC
(R&TTE) for which following EEA Member States apply restrictions on the placing on the market or on the putting into service or require authorisation for use:
Russia Ukraine (max. 10 mW output power, 433.050 -
434.790 MHz) Georgia Serbia The conformity for countries with other national regulations not covered by the FCC part 15 and 90 or European directive 1999/5/EC has to be approved prior to use and operation. Japanese Radio Law and Japanese Telecommunications Business Law Compliance. This device is granted pursuant to the Japanese Radio Law (
) and the Japa-
nese Telecommunications Business Law (
). This device should not be modified (otherwise the granted designation number will become invalid). Frequency band 348.56 MHz - 348.80 MHz Output power Receive only Antenna The appropriate antenna must be ordered directly from your local Tescom Office or Representative. Specific Absorption Rate (SAR) The product meets the limits for the maximum permissible exposure of the guide-lines and standards which are force in this respect. The product must be used with the recommended antenna. A separation distance of at least 20 centimetres should be kept between the antenna and the body of the user or nearby person within the intended application. iCON gps 80, Technical Data 103 9.4.6 CCD14 - SATEL TA13 Conformity to national regulations FCC Part 15 and 90 (applicable in US) Hereby, Leica Geosystems AG, declares that the product CCD14 is in compliance with the essential requirements and other relevant provisions of Directive 1999/5/EC and other applicable European Directives. The declaration of conformity can be consulted at http://www.leica-geosystems.com/ce. This Class 2 equipment may be operated in: AT, BE, CY, CZ, DK, EE, FI, FR, DE, GR, HU, IE, IT, LV, LT, LU, MT, NL, PL, PT, SK, SI, ES, SE, GB, IS, LI, NO, CH, BG, RO and TR. Class 2 equipment according European Directive 1999/5/EC
(R&TTE) for which following EEA Member States apply restrictions on the placing on the market or on the putting into service or require authorisation for use:
Russia Ukraine (max. 10 mW output power, 433.050 -
434.790 MHz) Georgia Serbia The conformity for countries with other national regulations not covered by the FCC part 15 and 90 or European directive 1999/5/EC has to be approved prior to use and operation. Japanese Radio Law and Japanese Telecommunications Business Law Compliance. This device is granted pursuant to the Japanese Radio Law (
) and the Japa-
nese Telecommunications Business Law (
). This device should not be modified (otherwise the granted designation number will become invalid). Frequency band 403 MHz - 470 MHz Output power CCD14:
0.5 W - 1.0 W Antenna Type Frequency band
[MHz]
Type Connector GAT1 400 - 435 GAT2 435 - 470 CA12 406 - 440 CA13 430 - 480 Detachable /2 antenna TNC Detachable /2 antenna TNC External stub antenna TNC (CA22, Magnetic antenna mount) External stub antenna TNC (CA22, Magnetic antenna mount) Specific Absorption Rate (SAR) The product meets the limits for the maximum permissible exposure of the guide-lines and standards which are force in this respect. The product must be used with the recommended antenna. A separation distance of at least 20 centimetres should be kept between the antenna and the body of the user or nearby person within the intended application. iCON gps 80, Technical Data 104 9.4.7 CCD15 - Intuicom 900SLR Conformity to national regulations FCC Part 15 and 90 (applicable in US) Hereby, Leica Geosystems AG, declares that the product CCD15 is in compliance with the essential requirements and other relevant provisions of Directive 1999/5/EC and other applicable European Directives. The declaration of conformity can be consulted at http://www.leica-geosystems.com/ce. This Class 2 equipment may be operated in: AT, BE, CY, CZ, DK, EE, FI, FR, DE, GR, HU, IE, IT, LV, LT, LU, MT, NL, PL, PT, SK, SI, ES, SE, GB, IS, LI, NO, CH, BG, RO and TR. Class 2 equipment according European Directive 1999/5/EC
(R&TTE) for which following EEA Member States apply restrictions on the placing on the market or on the putting into service or require authorisation for use:
Russia Ukraine (max. 10 mW output power, 433.050 -
434.790 MHz) Georgia Serbia The conformity for countries with other national regulations not covered by the FCC part 15 and 90 or European directive 1999/5/EC has to be approved prior to use and operation. Japanese Radio Law and Japanese Telecommunications Business Law Compliance. This device is granted pursuant to the Japanese Radio Law (
) and the Japa-
nese Telecommunications Business Law (
). This device should not be modified (otherwise the granted designation number will become invalid). Frequency band 902 MHz - 928 MHz Output power 5 mW - 1 W Antenna Type Frequency band [MHz]
Type Connector CA6 902 - 928 Detachable /2 antenna TNC (CA22, Magnetic antenna mount) CA26 698 - 2700 External stub antenna TNC (CA22, Magnetic antenna mount) iCON gps 80, Technical Data 105 10 Software Licence Agreement Software Licence Agreement Open source infor-
mation This product contains software that is preinstalled on the product, or that is supplied to you on a data carrier medium, or that can be downloaded by you online according to prior authorisation from Leica Geosystems. Such software is protected by copyright and other laws and its use is defined and regulated by the Leica Geosystems Software Licence Agreement, which covers aspects such as, but not limited to, Scope of the Licence, Warranty, Intellectual Property Rights, Limitation of Liability, Exclusion of other Assurances, Governing Law and Place of Jurisdiction. Please make sure, that at any time you fully comply with the terms and conditions of the Leica Geosystems Soft-
ware Licence Agreement. Such agreement is provided together with all products and can also be referred to and downloaded at the Leica Geosystems home page at http://leica-geosystems.com/about-us/compliance-standards/legal-documents or collected from your Leica Geosystems distributor. You must not install or use the software unless you have read and accepted the terms and conditions of the Leica Geosystems Software Licence Agreement. Installation or use of the software or any part thereof, is deemed to be an acceptance of all the terms and conditions of such Licence Agreement. If you do not agree to all or some of the terms of such Licence Agreement, you must not download, install or use the software and you must return the unused software together with its accompanying documentation and the purchase receipt to the distributor from whom you purchased the product within ten (10) days of purchase to obtain a full refund of the purchase price. The software on the product may contain copyright-protected software that is licensed under various open source licences. Copies of the corresponding licences are provided together with the product (for example in the About panel of the soft-
ware) can be downloaded on http://opensource.leica-geosystems.com/icon If foreseen in the corresponding open source licence, you may obtain the corre-
sponding source code and other related data on http://opensource.leica-
geosystems.com/icon. Contact opensource@leica-geosystems.com in case you need additional information. iCON gps 80, Software Licence Agreement 106 Appendix A A.1 NMEA Message Formats Overview Description National Marine Electronics Association is a standard for interfacing marine electronic devices. This chapter describes all NMEA-0183 messages which can be output by the instrument. Access
A.2 Select Settings > Tools > NMEA Output. A Talker ID appears at the beginning of the header of each NMEA message. The Talker ID can be user defined or standard (based on the NMEA 4.0). The standard is normally GP for GPS but can be changed in Settings > Tools > NMEA Output. Symbols Used for Describing the NMEA Formats Description NMEA messages consist of various fields. The fields are:
Header Special format fields Numeric value fields Null fields Information fields Certain symbols are used as identifier for the field types. These symbols are described in this section. Header Symbol
$
--ccc Field
-
Address Description Start of sentence
-- = alphanumeric characters identi-
fying the talker Options:
GN = Global Navigation Satellite System GP = GPS only GL = GLONASS GA = Galileo BD = BeiDou ccc = alphanumeric characters identi-
fying the data type and string format of the successive fields. Usually the name of the message. Example
$
GNGGA GPGGA GLGGA GAGGA BDGGA iCON gps 80, NMEA Message Formats 107 Special format fields Symbol A Field Status llll.ll Latitude Description A = Yes, Data Valid, Warning Flag Clear V V = No, Data Invalid, Warning Flag Set Degreesminutes.decimal Two fixed digits of degrees, two fixed digits of minutes and a variable number of digits for decimal fraction of minutes. Example 4724.538950 Leading zeros are always included for degrees and minutes to maintain fixed length. yyyyy.yy Longitude Degreesminutes.decimal 00937.04678 5 Three fixed digits of degrees, two fixed digits of minutes and a variable number of digits for decimal fraction of minutes. Leading zeros are always included for degrees and minutes to maintain fixed length. At the most six fixed digits for metres and three fixed digits for decimal frac-
tions of metres. eeeeee.eee Grid Easting hhmmss.ss Time nnnnnn.nnn Grid Northing At the most six fixed digits for metres and three fixed digits for decimal frac-
tions of metres. hoursminutesseconds.decimal Two fixed digits of hours, two fixed digits of minutes, two fixed digits of seconds and a variable number of digits for decimal fraction of seconds. Leading zeros are always included for hours, minutes and seconds to main-
tain fixed length. 195233.507 127223.793 115744.00 mmddyy Date No specific symbol Defined field Monthdayyear - two fixed digits of month, two fixed digits of day, two fixed digits of year. Leading zeros always included for month, day and year to maintain fixed length. 093003 Some fields are specified to contain predefined constants, most often alpha characters. M Such a field is indicated by the pres-
ence of one or more valid characters. Excluded from the list of valid charac-
ters are the following that are used to indicate other field types: A, a, c, x, hh, hhmmss.ss, llll.ll, yyyyy.yy. iCON gps 80, NMEA Message Formats 108 Numeric value fields Symbol x.x Field Variable numbers Description Integer or floating numeric field Example 73.10 =
73.1 =
073.1 = 73 Information fields Optional leading and trailing zeros. Decimal point and associated decimal-
fraction are optional if full resolution is not required. hh_ Fixed HEX field Fixed length HEX numbers 3F Symbol c--c aa_ xx_ Field Variable text Fixed alpha field Fixed number field Description Variable length valid character field Fixed length field of upper case or lower case alpha characters Fixed length field of numeric characters Example A N 1 Null fields
A.3 Symbol No symbol Field Information unavailable for output Description Null fields do not contain any informa-
tion. Example
,, Fields are always separated by a comma. Before the Checksum field there is never a comma. When information for a field is not available, the position in the data string is empty. GGA - Global Positioning System Fix Data Syntax
$--GGA,hhmmss.ss,llll.ll,a,yyyyy.yy,a,x,xx,x.x,x.x,M,x.x,M,x.x,xxxx*hh<CR><LF>
Description of fields Description Header including Talker ID Field
$--GGA hhmmss.ss UTC time of position Latitude (WGS 1984) llll.ll Hemisphere, North or South a Longitude (WGS 1984) yyyyy.yy a East or West Position quality indicator x 0 = Fix not available or invalid 1 = No real-time position, navigation fix 2 = Real-time position, ambiguities not fixed 3 = Valid fix for GNSSPrecise Positioning Service mode, for example WAAS 4 = Real-time position, ambiguities fixed Number of satellites in use. For $GNGGA messages: The combined GPS, GLONASS, Galileo and BeiDou satellites used in the position. xx iCON gps 80, NMEA Message Formats 109 Examples A.4 Syntax Description of fields Field x.x x.x M x.x M x.x xxxx
*hh
<CR>
<LF>
Description HDOP Altitude of position marker above/below mean sea level in metres. If no orthometric height is available the local ellipsoidal height will be exported. If the local ellipsoidal height is not available either, the WGS 1984 ellipsoidal height will be exported. Units of altitude as fixed text M Geoidal separation in metres. The Geoidal separation is the difference between the WGS 1984 earth ellipsoid surface and mean sea level. Units of geoidal separation as fixed text M Age of differential GNSS data, empty when DGPS not used Differential base station ID, 0000 to 1023 Checksum Carriage Return Line Feed User-defined Talker ID = GN
$GNGGA,113805.50,4724.5248541,N,00937.1063044,E,4,13,0.7,1171.281,M,-
703.398, M,0.26,0000*42 GGK - Real-Time Position with DOP
$--GGK,hhmmss.ss,mmddyy,llll.ll,a,yyyyy.yy,a,x,xx,x.x,EHTx.x,M*hh<CR><LF>
Description Header including Talker ID Field
$--GGK hhmmss.ss UTC time of position mmddyy llll.ll a yyyyy.yy a x UTC date Latitude (WGS 1984) Hemisphere, North or South Longitude (WGS 1984) East or West Position quality indicator 0 = Fix not available or invalid 1 = No real-time position, navigation fix 2 = Real-time position, ambiguities not fixed 3 = Real-time position, ambiguities fixed 5 = Real-time position, float Number of satellites in use. For $GNGGK messages: The combined GPS, GLONASS, Galileo and BeiDou satellites used in the position. GDOP Ellipsoidal height Altitude of position marker as local ellipsoidal height. If the local ellip-
soidal height is not available, the WGS 1984 ellipsoidal height will be exported. xx x.x EHT x.x iCON gps 80, NMEA Message Formats 110 Examples A.5 Syntax Description of fields Field M
*hh
<CR>
<LF>
Description Units of altitude as fixed text M Checksum Carriage Return Line Feed Standard Talker ID
$GNGGK,113616.00,041006,4724.5248557,N,00937.1063064,E,3,12,1.7,EHT1171. 742,M*6D User-defined Talker ID = GN
$GNGGK,113806.00,041006,4724.5248557,N,00937.1063064,E,3,13,1.4,EHT1171. 746,M*66 GGQ - Real-Time Position with CQ
$--GGQ,hhmmss.ss,mmddyy,llll.ll,a,yyyyy.yy,a,x,xx,x.x,x.x,M*hh<CR><LF>
Description Header including talker ID Field
$--GGQ hhmmss.ss UTC time of position mmddyy llll.ll a yyyyy.yy a x UTC date Latitude (WGS 1984) Hemisphere, North or South Longitude (WGS 1984) East or West Position quality indicator 0 = Fix not available or invalid 1 = No real-time position, navigation fix 2 = Real-time position, ambiguities not fixed 3 = Real-time position, ambiguities fixed 5 = Real-time position, float Number of satellites in use. For $GNGGQ messages: The combined GPS, GLONASS, Galileo and BeiDou satellites used in the position. Coordinate quality in metres Altitude of position marker above/below mean sea level in metres. If no orthometric height is available the local ellipsoidal height will be exported. If the local ellipsoidal height is not available either, the WGS 1984 ellipsoidal height will be exported. Units of altitude as fixed text M Checksum Carriage Return Line Feed xx x.x x.x M
*hh
<CR>
<LF>
iCON gps 80, NMEA Message Formats 111 Examples A.6 Syntax Description of fields Standard Talker ID
$GNGGQ,113615.50,041006,4724.5248556,N,00937.1063059,E,3,12,0.009,1171.2 81,M*22
$GPGGQ,113615.50,041006,,,,08,,*67
$GLGGQ,113615.50,041006,,,,04,,*77 User-defined Talker ID = GN
$GNGGQ,113805.50,041006,4724.5248541,N,00937.1063044,E,3,13,0.010,1171.2 81,M*2E GLL - Geographic Position Latitude/Longitude
$--GLL,llll.ll,a,yyyyy.yy,a,hhmmss.ss,A,a*hh<CR><LF>
Description Header including talker ID Latitude (WGS 1984) Hemisphere, North or South Longitude (WGS 1984) East or West Field
$--GLL llll.ll a yyyyy.yy a hhmmss.ss UTC time of position A Status A = Data valid V = Data not valid Mode indicator A = Autonomous mode D = Differential mode N = Data not valid Checksum Carriage Return Line Feed a
*hh
<CR>
<LF>
Examples The Mode indicator field supplements the Status field. The Status field is set to A for the Mode indicators A and D. The Status field is set to V for the Mode indicator N. Standard Talker ID
$GNGLL,4724.5248556,N,00937.1063059,E,113615.50,A,D*7B User-defined Talker ID = GN
$GNGLL,4724.5248541,N,00937.1063044,E,113805.50,A,D*7E iCON gps 80, NMEA Message Formats 112 A.7 Syntax Description of fields GNS - GNSS Fix Data
$--GNS,hhmmss.ss,llll.ll,a,yyyyy.yy,a,c--c,xx,x.x,x.x,x.x,x.x,xxxx,h*hh<CR><LF>
Description Header including talker ID Field
$--GNS hhmmss.ss UTC time of position Latitude (WGS 1984) llll.ll Hemisphere, North or South a yyyyy.yy Longitude (WGS 1984) East or West a Mode indicator c--c N = Satellite system not used in position fix or fix not valid A = Autonomous; navigation fix, no real-time fix D = Differential; real-time position, ambiguities not fixed R = Real-time kinematic; ambiguities fixed Number of satellites in use, 00 to 99 HDOP Altitude of position marker above/below mean sea level in metres. If no orthometric height is available the local ellipsoidal height will be exported. If the local ellipsoidal height is not available either, the WGS 1984 ellipsoidal height will be exported. Geoidal separation in metres Age of differential data Differential base station ID, 0000 to 1023 Checksum Carriage Return Line Feed x.x x.x xxxx
*hh
<CR>
<LF>
xx x.x x.x Examples Standard Talker ID
$GNGNS,113616.00,4724.5248557,N,00937.1063064,E,RR,12,0.9,1171.279,-
703.398,0.76,0000*6C
$GPGNS,113616.00,,,,,,08,,,,,*69
$GLGNS,113616.00,,,,,,04,,,,,*79 User-defined Talker ID = GN
$GNGNS,113806.00,4724.5248547,N,00937.1063032,E,R,13,0.7,1171.283,-
703.398,0.76,0000*39 iCON gps 80, NMEA Message Formats 113 A.8 Syntax Description of fields GSA - GNSS DOP and Active Satellites
$--GSA,a,x,xx,xx,xx,xx,xx,xx,xx,xx,xx,xx,xx,xx,x.x,x.x,x.x,h*hh<CR><LF>
Field
$--GSA a x xx x.x x.x x.x
*hh
<CR>
<LF>
Description Header including talker ID Mode M = Manual, forced to operate in 2D or 3D mode A = Automatic, allowed to change automatically between 2D and 3D Mode 1 = Fix not available 2 = 2D 3 = 3D Numbers of the satellites used in the solution. This field is repeated 12 times. 1 to 32 = PRN numbers of GPS satellites 33 to 64 = Numbers of WAAS and WAAS like satellites 65 to 96 = Slot numbers of GLONASS satellites PDOP HDOP VDOP Checksum Carriage Return Line Feed Examples Standard Talker ID
$GNGSA,A,3,01,11,14,17,19,20,24,28,,,,,1.5,0.9,1.2*26
$GNGSA,A,3,65,66,67,81,,,,,,,,,1.5,0.9,1.2*29 User-defined Talker ID = GN
$GNGSA,A,3,01,11,14,17,19,20,23,24,28,,,,65,66,67,81,,,,,,,,,1.2,0.7,1.0*27 iCON gps 80, NMEA Message Formats 114 A.9 Syntax Description of fields
Examples GSV - GNSS Satellites in View
$--GSV,x,x,xx,xx,xx,xxx,xx,.....,h*hh<CR><LF>
Field
$--GSV x x xx xx xx xxx xx
...
*hh
<CR>
<LF>
Description Header including talker ID Total number of messages, 1 to 4 Message number, 1 to 4 Number of theoretically visible satellites according to the current almanac. PRN (GPS) / Slot (GLONASS) number of satellite Elevation in degrees, 90 maximum, empty when not tracking Azimuth in degrees true north, 000 to 359, empty when not tracking Signal to Noise Ration C/No in dB, 00 to 99 of L1 signal, null field when not tracking. Repeat set PRN / Slot number, elevation, azimuth and SNR up to four times Checksum Carriage Return Line Feed Satellite information can require the transmission of multiple messages, specified by the total number of messages and the message number. The fields for the PRN / Slot number, Elevation, Azimuth and SNR form one set. A vari-
able number of these sets are allowed up to a maximum of four sets per message. Standard Talker ID
$GPGSV,3,1,11,01,55,102,51,11,85,270,50,14,31,049,47,17,21,316,46*7A
$GPGSV,3,2,11,19,31,172,48,20,51,249,50,22,00,061,,23,11,190,42*7E
$GPGSV,3,3,11,24,11,292,43,25,08,114,,28,14,275,44,,,,*45
$GLGSV,2,1,06,65,16,055,42,66,64,025,48,67,46,262,42,68,01,245,*64
$GLGSV,2,2,06,81,52,197,47,83,07,335,,,,,,,,,*68 User-defined Talker ID = GN
$GNGSV,3,1,10,01,55,100,51,11,86,263,50,14,31,049,47,17,22,316,46*65
$GNGSV,3,2,10,19,30,172,48,20,52,249,51,23,12,190,42,24,12,292,42*6C
$GNGSV,3,3,10,25,09,114,,28,14,274,44,,,,,,,,*62 iCON gps 80, NMEA Message Formats 115 A.10 Syntax Description of fields Examples A.11 Syntax Description of fields HDT - Heading, True
$--HDT,x.x,T*hh<CR><LF>
Field
$--HDT x.x T
*hh
<CR>
<LF>
Description Header including talker ID Heading, degrees True Fixed text T for true north Checksum Carriage Return Line Feed Standard Talker ID
$GNHDT,11.4,T, 00*4B LLK - Leica Local Position and GDOP
$--LLK,hhmmss.ss,mmddyy,eeeeee.eee,M,nnnnnn.nnn,M,x,xx,x.x,x.x,M*hh<CR><LF>
UTC date Description Header including talker ID Field
$--LLK hhmmss.ss UTC time of position mmddyy eeeeee.eee Grid Easting in metres M nnnnnn.nnn Grid Northing in metres M x Units of grid Easting as fixed text M Units of grid Northing as fixed text M Position quality 0 = Fix not available or invalid 1 = No real-time position, navigation fix 2 = Real-time position, ambiguities not fixed 3 = Real-time position, ambiguities fixed 5 = Real-time position, float Number of satellites in use. For $GNLLK messages: The combined GPS, GLONASS, Galileo and BeiDou satellites used in the position. GDOP Altitude of position marker above/below mean sea level in metres. If no orthometric height is available the local ellipsoidal height will be exported. Units of altitude as fixed text M Checksum Carriage Return Line Feed xx x.x x.x M
*hh
<CR>
<LF>
iCON gps 80, NMEA Message Formats 116 Examples A.12 Syntax Description of fields Standard Talker ID
$GNLLK,113616.00,041006,764413.024,M,252946.774,M,3,12,1.7,1171.279,M*0F
$GPLLK,113616.00,041006,,,,,,08,,,*57
$GLLLK,113616.00,041006,,,,,,04,,,*47 User-defined Talker ID = GN
$GNLLK,113806.00,041006,764413.021,M,252946.772,M,3,13,1.4,1171.283,M*04 LLQ - Leica Local Position and Quality
$--LLQ,hhmmss.ss,mmddyy,eeeeee.eee,M,nnnnnn.nnn,M,x,xx,x.x,x.x,M*hh<CR><LF>
UTC date Description Header including talker ID Field
$--LLQ hhmmss.ss UTC time of position mmddyy eeeeee.eee Grid Easting in metres M nnnnnn.nnn Grid Northing in metres M x Units of grid Easting as fixed text M Units of grid Northing as fixed text M Position quality 0 = Fix not available or invalid 1 = No real-time position, navigation fix 2 = Real-time position, ambiguities not fixed 3 = Real-time position, ambiguities fixed 5 = Real-time position, float Number of satellites in use. For $GNLLQ messages: The combined GPS, GLONASS, Galileo and BeiDou satellites used in the position. Coordinate quality in metres Altitude of position marker above/below mean sea level in metres. If no orthometric height is available the local ellipsoidal height will be exported. Units of altitude as fixed text M Checksum Carriage Return Line Feed xx x.x x.x M
*hh
<CR>
<LF>
Examples Standard Talker ID
$GNLLQ,113616.00,041006,764413.024,M,252946.774,M,3,12,0.010,1171.279,M*
12
$GPLLQ,113616.00,041006,,,,,,08,,,*4D
$GLLLQ,113616.00,041006,,,,,,04,,,*5D User-defined Talker ID = GN
$GNLLQ,113806.00,041006,764413.021,M,252946.772,M,3,13,0.010,1171.283,M*
1A iCON gps 80, NMEA Message Formats 117 A.13 Syntax Description of fields RMC - Recommended Minimum Specific GNSS Data
$--RMC,hhmmss.ss,A,llll.ll,a,yyyyy.yy,a,x.x,x.x,xxxxxx,x.x,a,a*hh<CR><LF>
Description Header including talker ID Field
$--RMC hhmmss.ss UTC time of position fix A Status A = Data valid V = Navigation instrument warning Latitude (WGS 1984) Hemisphere, North or South Longitude (WGS 1984) East or West Speed over ground in knots Course over ground in degrees Date: ddmmyy Magnetic variation in degrees East or West Mode Indicator A = Autonomous mode D = Differential mode N = Data not valid Carriage Return Line Feed llll.ll a yyyyy.yy a x.x x.x xxxxxx x.x a a*hh
<CR>
<LF>
Examples Standard Talker ID A.14 Syntax Description of fields
$GNRMC,113616.00,A,4724.5248557,N,00937.1063064,E,0.01,11.43,100406,11.4 3,E,D*1C User-defined Talker ID = GN
$GNRMC,113806.00,A,4724.5248547,N,00937.1063032,E,0.00,287.73,100406,287
.73,E,D*10 VTG - Course Over Ground and Ground Speed
$--VTG,x.x,T,x.x,M,x.x,N,x.x,K,a*hh<CR><LF>
Field
$--VTG x.x T x.x M x.x N Description Header including talker ID Course over ground in degrees true north, 0.0 to 359.9 Fixed text T for true north Course over ground in degrees magnetic North, 0.0 to 359.9 Fixed text M for magnetic North Speed over ground in knots Fixed text N for knots iCON gps 80, NMEA Message Formats 118 Examples A.15 Syntax Description of fields Field x.x K a
*hh
<CR>
<LF>
Description Speed over ground in km/h Fixed text K for km/h Mode Indicator A = Autonomous mode D = Differential mode N = Data not valid Checksum Carriage Return Line Feed Standard Talker ID
$GNVTG,11.4285,T,11.4285,M,0.007,N,0.013,K,D*3D User-defined Talker ID = GN
$GNVTG,287.7273,T,287.7273,M,0.002,N,0.004,K,D*3E XDR Transducer Measurements
$--XDR,A,x.x,D,PITCH,A,x.x,A,YAW*hh<CR><LF>
Field
$--XDR A x.x D PITCH A x.x D YAW
*hh
<CR>
<LF>
Description Header including talker ID Transducer type: angular displacement Pitch Measurement data Units of measure is Degrees Transducer #1 ID: PITCH Transducer type: angular displacement Yaw Measurement data Units of measure is Degrees Transducer #2 ID: YAW Checksum Carriage Return Line Feed Examples Standard Talker ID
$GPXDR,A,0.071,D,PITCH,A,228.132,D,YAW*5E iCON gps 80, NMEA Message Formats 119 A.16 Syntax Description of fields
Examples ZDA - Time and Date
$--ZDA,hhmmss.ss,xx,xx,xxxx,xx,xx*hh<CR><LF>
Description Header including talker ID Field
$--ZDA hhmmss.ss UTC time xx xx xxxx xx xx
*hh
<CR>
<LF>
UTC day, 01 to 31 UTC month, 01 to 12 UTC year Local zone description in hours, 00 to 13 Local zone description in minutes, 00 to +59 Checksum Carriage Return Line Feed This message is given high priority and is output as soon as it is created. Latency is therefore reduced to a minimum. Standard Talker ID
$GPZDA,091039.00,01,10,2003,-02,00*4B User-defined Talker ID = GN
$GNZDA,113806.00,10,04,2006,02,00*76 iCON gps 80, NMEA Message Formats 120 Appendix B ORP Orientation and Position Description Access Description of fields This proprietary Leica message provides the current Position and Quality in either Geodetic or Grid coordinates for one or two antennas plus the resulting orientation. Select Settings > Tools > NMEA Output. Select NMEA Out 1 or NMEA Out 2 and toggle to Edit. ORP is available on the second page of the wizard. Position Status Flag - 1st Antenna3 Description Header, message sent from instrument Message Identifier ControlType1 Coordinate System2 Message type Format
$PLEIR, RESPONSE:
Position and ORP, Quality xxxx, x, The following block is available if Control Type = 1 or = 2 (Single or Dual GNSS) x, If Position Status Flag - 1st Antenna != "0" (not computed yet) and
!= 4 (not used) UTC time hhmmss.ss, UTC date ddmmyy, xx, Latency4 [milliseconds]
Quality Latitude/Northing [metres]
xx.xx, Quality Longitude/Easting [metres]
xx.xx, Quality Height [metres]
xx.xx, GDOP Value for first Antenna xx.xx, Number of Satellites used in Computation (GPS) x, x, Number of Satellites used in Computation (GG) If Coordinate System = 0 (Geodetic) the following block is present:
llll.ll, yyyyy.yy, xxxx.xxxx, If Coordinate System = 1 (Grid) the following block is present:
xxxx.xxxx, xxxx.xxxx, xxxx.xxxx, x, Grid Northing [metres]
Grid Easting [metres]
Altitude of position marker [metres]
Height type6 Latitude (+: North -: South) Longitude (+: East -: West) Altitude of position marker5 [metres]
iCON gps 80, ORP Orientation and Position 121 Message type Format Description Position Status Flag - 2nd antenna3 Latitude (+: North -: South) Longitude (+: East -: West) Altitude of position marker5 [metres]
UTC time UTC date Latency4 [milliseconds]
Quality Latitude/Northing [metres]
Quality Longitude/Easting [metres]
Quality Height [metres]
The following block is only available if Control Type = 2 (Dual GNSS) x, If Position Status Flag - 2nd Antenna != "0" (not computed yet) and
!= 4 (not used) hhmmss.ss, ddmmyy, xx, xx.xx, xx.xx, xx.xx, If Coordinate System = 0 (Geodetic) the following block is present:
llll.ll, yyyyy.yy, xxxx.xxxx, If Coordinate System = 1 (Grid) the following block is present:
xxxx.xxxx, xxxx.xxxx, xxxx.xxxx, x, The following block is only available if Control Type = 3 hhmmss.ss, ddmmyy, xx, xxxx.xxxx, xx.xx,
*hh
<CR>
<LF>
UTC time UTC date Latency4 [milliseconds]
Orientation Angle7 [degrees], 0.0 to 359.9 Quality of calculated Orientation [degrees]
Checksum Carriage Return Line Feed Grid Northing [metres]
Grid Easting [metres]
Altitude of position marker [metres]
Height type6 1 2 3 Control Type 1: Antenna1 Position Information 2: Antenna1 and Antenna2 Information 3: Antenna1 and Antenna2 Information + Orientation Coordinate System 0: WGS Geodetic 1: Local Grid Position Status 0: Computed Position not yet available 1: Differential code Position 2: Differential phase Position 3: Non-differential Position 4: xRTK iCON gps 80, ORP Orientation and Position 122 4 5 Latency given is defined as the difference in time between the UTC of the meas-
urements used in the computation and the UTC of the first Message byte sent out the instrument port. Ellipsoidal height is forced for Geodetic coordinates. Orthometric height is forced for Grid coordinates. 6 Height 0: Ellipsoidal height 1: Orthometric height 7 Orientation is available for Local Grid and WGS84. Example
$PLEIR,ORP,3,1,2,084709.25,310713,50,0.006,0.005,0.016,1.847,5,7,5250781.241
,546672.161,371.528,1,254,084709.25,310713,100,0.005,0.004,0.012,5250781.2 77,546671.390,371.497,1,084709.25,310713,100,272.683,0.592*23 iCON gps 80, ORP Orientation and Position 123 Appendix C C.1 Glossary C Coordinate system -
elements The five elements which define a coordinate system are:
a transformation a projection an ellipsoid a geoid model a Country Specific Coordinate System model Z Z Y d Y X e f g h i X a b c GS_042 a) WGS 1984 cartesian: X, Y, Z b) WGS 1984 ellipsoid c) WGS 1984 geodetic: Latitude, longi-
tude, ellipsoidal height d) 7 parameter transformation: dX, dY, dZ, rx, ry, rz, scale e) Local cartesian: X, Y, Z f) Local ellipsoid g) Local geodetic: Latitude, longitude, ellipsoidal height h) Local projection i) Local grid: Easting, Northing, ortho-
metric height CSCS model (*.ccg) All these elements can be specified when creating a coordinate system. Description Country Specific Coordinate System models are tables of correction values to convert coordinates directly from WGS 1984 to local grid without the need of transformation parameters. take the distortions of the mapping system into account. are an addition to an already defined coordinate system. Types of CSCS models The correction values of a CSCS model can be applied at different stages in the coor-
dinate conversion process. Depending on this stage, a CSCS model works differently. Three types of CSCS models are supported. Their conversion process is as explained in the following table. Any suitable geoid model can be combined with a geodetic CSCS model. Type Grid Description 1 Determination of preliminary grid coordinates by applying the spec-
ified transformation, ellipsoid and map projection. 2 Determination of the final local grid coordinates by applying a shift in Easting and Northing interpolated in the grid file of the CSCS model. iCON gps 80, Glossary 124 Type Cartesian Geodetic Description 1 Performing the specified transformation. 2 Determination of local cartesian coordinates by applying a 3D shift interpolated in the grid file of the CSCS model. 3 Determination of the final local grid coordinates by applying the specified local ellipsoid and map projection. 1 Determination of local geodetic coordinates by applying a correction in latitude and longitude interpolated from the file of the CSCS model. 2 Determination of the final local grid coordinates by applying the local map projection.
Using a geodetic CSCS model excludes the use of a transforma-
tion in a coordinate system. C.2 G Geoid model Description GPS operates on the WGS 1984 ellipsoid and all heights obtained by measuring base-
lines are ellipsoidal heights. Existing heights are usually orthometric heights, also called height above the geoid, height above mean sea level or levelled height. The mean sea level corresponds to a surface known as the geoid. The relation between ellipsoidal height and orthometric height is Orthometric Height = Ellipsoidal Height - Geoid Separation N P0 d1 d2 GS_043 a b a WGS 1984 ellipsoid b Geoid P0 Measured point d1 Ellipsoidal height d2 Geoid separation N, is nega-
tive when the geoid is below the ellipsoid N value and geoid model The geoid separation (N value) is the distance between the geoid and the reference ellipsoid. It can refer to the WGS 1984 or to the local ellipsoid. It is not a constant except over maybe small flat areas such as 5 km x 5 km. Therefore it is necessary to model the N value to obtain accurate orthometric heights. The modelled N values form a geoid model for an area. With a geoid model attached to a coordinate system, N values for the measured points can be determined. Ellipsoidal heights can be converted to orthometric heights and back. Geoid models are an approximation of the N value. In terms of accuracy, they can vary considerably and global models in particular should be used with caution. If the accu-
racy of the geoid model is not known, it can be safer to use local control points with orthometric heights and apply a transformation to approximate the local geoid. iCON gps 80, Glossary 125 Geoid field file C.3 Ntrip Ntrip Caster Ntrip Client The geoid separations in a geoid field file can be used in the field to change between ellipsoidal and orthometric heights. Creation:
Export onto a USB Memory device or the internal memory of the instrument.
*.grd Extension:
N Networked Transport of RTCM via Internet Protocol is a protocol streaming real-time corrections over the Internet. is a generic protocol based on the Hypertext Transfer Protocol HTTP/1.1. is used to send differential correction data or other kinds of streaming data to stationary or mobile users over the Internet. This process allows simultaneous computer, laptop, PDA, or instrument connections to a broadcasting host. supports wireless Internet access through mobile IP networks like digital cellular phones or modems. The Ntrip Server could be the GPS instrument itself. This setup means the GPS instru-
ment is both the Ntrip Source generating the real-time data and also the NTRIP Server transferring this data to the Ntrip Caster. NTRiPClient NTRiPServer N T R i P C a st e r InternetServer GS_044 Ntrip and its role in the Internet The Ntrip Caster is an Internet server handling various data streams to and from the Ntrip Servers and Ntrip Clients. checks the requests from Ntrip Clients and Ntrip Servers to see if they are regis-
tered to receive or provide real-time corrections. decides whether there is streaming data to be sent or to be received. The Ntrip Client receives data streams. This setup could be, for example a real-time rover receiving real-time corrections. In order to receive real-time corrections, the Ntrip Client must first send a user ID a password an identification name, the so-called Mountpoint, from which real-time corrections are to be received to the Ntrip Caster. iCON gps 80, Glossary 126 Ntrip Server The Ntrip Server transfers data streams. In order to send real-time corrections, the Ntrip Server must first send a password an identification name, the so-called Mountpoint, where the real-time corrections come from to the Ntrip Caster. Before sending real-time corrections to the Ntrip Caster for the first time, a registra-
tion form must be completed. This form is available from the Ntrip Caster administra-
tion centre. Refer to the website of the Ntrip Caster administration centre. Ntrip Source The Ntrip Source generates data streams. This setup could be base sending out real-
time corrections. Ntrip system components Ntrip consists of three system components:
Ntrip Clients Ntrip Servers Ntrip Caster C.4 WGS 1984 W WGS 1984 is the global geocentric datum to which all GNSS positioning information is referred to. iCON gps 80, Glossary 127 818347-2.7.0en Original text Printed in Switzerland 2016 Leica Geosystems AG, Heerbrugg, Switzerland Leica Geosystems AG Heinrich-Wild-Strasse CH-9435 Heerbrugg Switzerland Phone +41 71 727 31 31 www.leica-geosystems.com
frequency | equipment class | purpose | ||
---|---|---|---|---|
1 | 2016-04-26 | 2402 ~ 2480 | DSS - Part 15 Spread Spectrum Transmitter | Original Equipment |
app s | Applicant Information | |||||
---|---|---|---|---|---|---|
1 | Effective |
2016-04-26
|
||||
1 | Applicant's complete, legal business name |
Leica Geosystems AG
|
||||
1 | FCC Registration Number (FRN) |
0009479130
|
||||
1 | Physical Address |
Heinrich-Wild-Strasse
|
||||
1 |
CH-9435
|
|||||
1 |
Heerbrugg, N/A CH
|
|||||
1 |
Switzerland
|
|||||
app s | TCB Information | |||||
1 | TCB Application Email Address |
j******@eurofins.de
|
||||
1 | TCB Scope |
A4: UNII devices & low power transmitters using spread spectrum techniques
|
||||
app s | FCC ID | |||||
1 | Grantee Code |
RFD
|
||||
1 | Equipment Product Code |
ICG8XNG
|
||||
app s | Person at the applicant's address to receive grant or for contact | |||||
1 | Name |
H**** J****
|
||||
1 | Title |
Director Global Quality Management
|
||||
1 | Telephone Number |
00417********
|
||||
1 | Fax Number |
00417********
|
||||
1 |
h******@leica-geosystems.com
|
|||||
app s | Technical Contact | |||||
1 | Firm Name |
Leica Geosystems Pty Ltd
|
||||
1 | Name |
A**** T******
|
||||
1 | Physical Address |
270 Gladstone Rd Dutton Park
|
||||
1 |
Brisbane, 4102
|
|||||
1 |
Australia
|
|||||
1 | Telephone Number |
00613******** Extension:
|
||||
1 | Fax Number |
00617********
|
||||
1 |
a******@leica-geosystems.com
|
|||||
app s | Non Technical Contact | |||||
n/a | ||||||
app s | Confidentiality (long or short term) | |||||
1 | Does this application include a request for confidentiality for any portion(s) of the data contained in this application pursuant to 47 CFR § 0.459 of the Commission Rules?: | Yes | ||||
1 | Long-Term Confidentiality Does this application include a request for confidentiality for any portion(s) of the data contained in this application pursuant to 47 CFR § 0.459 of the Commission Rules?: | Yes | ||||
1 | If so, specify the short-term confidentiality release date (MM/DD/YYYY format) | 10/23/2016 | ||||
if no date is supplied, the release date will be set to 45 calendar days past the date of grant. | ||||||
app s | Cognitive Radio & Software Defined Radio, Class, etc | |||||
1 | Is this application for software defined/cognitive radio authorization? | No | ||||
1 | Equipment Class | DSS - Part 15 Spread Spectrum Transmitter | ||||
1 | Description of product as it is marketed: (NOTE: This text will appear below the equipment class on the grant) | iCG80 - GNSS Receiver for Machine Control | ||||
1 | Related OET KnowledgeDataBase Inquiry: Is there a KDB inquiry associated with this application? | No | ||||
1 | Modular Equipment Type | Does not apply | ||||
1 | Purpose / Application is for | Original Equipment | ||||
1 | Composite Equipment: Is the equipment in this application a composite device subject to an additional equipment authorization? | No | ||||
1 | Related Equipment: Is the equipment in this application part of a system that operates with, or is marketed with, another device that requires an equipment authorization? | No | ||||
1 | Grant Comments | Power listed is conducted! | ||||
1 | Is there an equipment authorization waiver associated with this application? | No | ||||
1 | If there is an equipment authorization waiver associated with this application, has the associated waiver been approved and all information uploaded? | No | ||||
app s | Test Firm Name and Contact Information | |||||
1 | Firm Name |
Eurofins Product Service GmbH
|
||||
1 | Name |
R**** K********
|
||||
1 | Telephone Number |
49-33********
|
||||
1 | Fax Number |
49-33********
|
||||
1 |
r******@eurofins.de
|
|||||
Equipment Specifications | |||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Line | Rule Parts | Grant Notes | Lower Frequency | Upper Frequency | Power Output | Tolerance | Emission Designator | Microprocessor Number | |||||||||||||||||||||||||||||||||
1 | 1 | 15C | 2402.00000000 | 2480.00000000 | 0.0030000 |
some individual PII (Personally Identifiable Information) available on the public forms may be redacted, original source may include additional details
This product uses the FCC Data API but is not endorsed or certified by the FCC